{"gene":"GRIK5","run_date":"2026-04-28T18:06:53","timeline":{"discoveries":[{"year":1992,"finding":"GluK5 (KA-2) binds [3H]kainate with high affinity (KD ~15 nM) but does not form functional homomeric channels; coexpression with GluR5(R) or GluR6 subunits produces agonist-gated currents, demonstrating that GluK5 requires heteromeric assembly with low-affinity subunits for channel function. Heteromeric GluR5(Q)/KA-2 channels show more rapid desensitization and altered current-voltage relations compared to GluR5(Q) homomers, and GluR6/KA-2 channels gain responsiveness to AMPA.","method":"Heterologous expression in Xenopus oocytes/HEK cells, electrophysiology, radioligand binding","journal":"Neuron","confidence":"High","confidence_rationale":"Tier 1 — reconstitution in heterologous system with multiple subunit combinations; foundational study replicated extensively","pmids":["1373632"],"is_preprint":false},{"year":1994,"finding":"GluK5 (KA2) and GluR6 subunits co-assemble into heteromeric complexes in transfected HEK cells and in native rat brain membranes, as demonstrated by reciprocal co-immunoprecipitation. KA2 runs at ~123 kDa (glycosylated) and ~109 kDa (deglycosylated), confirming it is a glycoprotein. Antibodies to GluR6 co-immunoprecipitate KA2 and vice versa from detergent-solubilized brain membranes, establishing the GluR6/KA2 heteromeric complex as a native brain entity.","method":"Co-immunoprecipitation, immunoblot, deglycosylation assay, [3H]kainate binding","journal":"The Journal of biological chemistry","confidence":"High","confidence_rationale":"Tier 2 — reciprocal Co-IP in both heterologous cells and native brain tissue","pmids":["8288598"],"is_preprint":false},{"year":1994,"finding":"GRIK5 (encoding KA2) maps to human chromosome 19q13.2, mouse chromosome 7, and rat chromosome 1, establishing its chromosomal localization as distinct from GRIK4 (KA1) on human chromosome 11q22.3.","method":"Southern analysis of somatic cell hybrid panels, fluorescence in situ hybridization, interspecific backcross mapping","journal":"Proceedings of the National Academy of Sciences of the United States of America","confidence":"High","confidence_rationale":"Tier 2 — direct FISH and somatic cell hybrid mapping, replicated across species","pmids":["7527545"],"is_preprint":false},{"year":1995,"finding":"KA2 (GluK5) is enriched at synaptic sites in hippocampal neurons, co-localizing with the synaptic vesicle marker synaptophysin in dendritic spines after ~14 days in culture. Despite co-localization with AMPA subunit GluR1 in the same spines, co-immunoprecipitation shows no direct interaction between GluR1 and KA2, confirming that AMPA and kainate receptor complexes remain distinct at synapses.","method":"Immunocytochemistry, co-immunoprecipitation in cultured hippocampal neurons","journal":"Neuroscience","confidence":"Medium","confidence_rationale":"Tier 2/3 — direct localization with synaptic marker plus negative Co-IP result; single lab","pmids":["8552236"],"is_preprint":false},{"year":1996,"finding":"Heteromeric GluR6(R)/KA2 channels have a ~2–3-fold larger unitary conductance (~572 fS) than homomeric GluR6(R) channels (~231–264 fS), as measured by noise analysis. GluR6(R)/KA2 heteromers are additionally activated by AMPA (which fails to gate homomeric GluR6), and show higher EC50 for kainate (~1.62 µM) compared to homomers (~0.47 µM).","method":"Patch-clamp electrophysiology (whole-cell noise analysis), transfected HEK293 cells","journal":"Journal of neurophysiology","confidence":"High","confidence_rationale":"Tier 1 — quantitative biophysical characterization of recombinant channels with defined subunit compositions","pmids":["8836240"],"is_preprint":false},{"year":1996,"finding":"RNA editing at the Q/R site of GluR5 and GluR6 dramatically reduces homomeric single-channel conductance. Coexpression of KA2 with GluR5(Q) dramatically shortens channel burst length, while coexpression with edited GluR5(R) or GluR6(R) increases mean single-channel conductance (~950 fS for GluR5(R)/KA2; ~700 fS for GluR6(R)/KA2) relative to the respective homomers.","method":"Outside-out patch-clamp single-channel recording and spectral/variance analysis, transfected HEK293 cells","journal":"The Journal of physiology","confidence":"High","confidence_rationale":"Tier 1 — single-channel biophysics with defined edited/unedited subunit combinations","pmids":["8730589"],"is_preprint":false},{"year":1997,"finding":"In rat trigeminal ganglion (TG) neurons, GluR5 and KA2 mRNAs are co-expressed at high levels, and the pharmacological, kinetic, rectification, and ion-permeability properties of native kainate currents closely match those of recombinant GluR5(R)/KA2 heteromeric channels, providing strong evidence that GluR5/KA2 heteromers are the predominant native kainate receptor in TG neurons.","method":"RT-PCR, patch-clamp electrophysiology of acutely dissociated neurons, pharmacological characterization","journal":"The Journal of neuroscience","confidence":"High","confidence_rationale":"Tier 2 — multiple orthogonal methods (molecular, electrophysiological, pharmacological) in native neurons","pmids":["9254673"],"is_preprint":false},{"year":1997,"finding":"The rat GRIK5 gene spans >54 kb and is composed of 20 exons. The 5'-flanking region confers tissue-specific expression, and the first intron contains a negative regulatory element (silencer) located within 500 bp of the intron's 3' end that inhibits transcription in an orientation- and distance-independent manner; a 24-nucleotide sequence within this region binds nuclear proteins and mediates silencer activity.","method":"Reporter gene (CAT) transfection assay, genomic library screening, footprinting, gel shift assays","journal":"The Journal of biological chemistry","confidence":"Medium","confidence_rationale":"Tier 2 — functional reporter assays with deletion analysis and protein-binding validation; single lab","pmids":["9079693"],"is_preprint":false},{"year":1998,"finding":"SAP90 (PSD-95) and SAP102 co-immunoprecipitate with KA2 (GluK5) from neurons. The KA2 C-terminal region binds specifically to the SH3 and GK domains of SAP90 (not the PDZ domains that bind GluR6). Co-expression of SAP90 with GluR6/KA2 receptors reduces desensitization of kainate-evoked currents, demonstrating that SAP90/PSD-95 family members modulate the electrophysiological properties of KA2-containing kainate receptors.","method":"Co-immunoprecipitation, yeast two-hybrid, transfected cell electrophysiology","journal":"Neuron","confidence":"High","confidence_rationale":"Tier 2 — Co-IP in neurons plus functional electrophysiological consequence, replicated with multiple SAP family members","pmids":["9808460"],"is_preprint":false},{"year":2001,"finding":"The intramolecular interaction of the SAP97 N-terminus with its own SH3 domain occludes the KA2-binding site on SAP97, explaining why SAP97 associates weakly with KA2 in vivo compared to SAP90. The individual SH3 and GK domains of SAP97 can bind KA2's C-terminal tail in vitro, but specific intramolecular contacts in full-length SAP97 prevent this interaction, revealing a mechanism for differential subcellular targeting of kainate receptors by distinct SAP family members.","method":"GFP-chimera expression, co-immunoprecipitation in HEK293 cells, in vitro binding assays with deletion mutants","journal":"The Journal of biological chemistry","confidence":"Medium","confidence_rationale":"Tier 2/3 — in vitro binding plus cell expression; mechanistic follow-up of SAP90 paper; single lab","pmids":["11279111"],"is_preprint":false},{"year":2001,"finding":"The GRIK5 promoter is TATA-less and GC-rich with multiple initiator sequences. A 1200 bp 5'-flanking region sustains neural cell-specific promoter activity via a TFIID-containing complex at an initiator sequence ~1100 bp upstream of intron 1. A 77-bp intronic/exonic sequence functions as a silencer in non-neural cells, containing a functional SP1-binding site and a neuron-restrictive silencer element-like sequence that suppresses GRIK5 expression in fibroblasts.","method":"Transgenic mouse lacZ reporter, reporter transfection assays, gel shift/EMSAs, deletion analysis","journal":"The Journal of biological chemistry","confidence":"Medium","confidence_rationale":"Tier 2 — in vivo transgenic reporter plus cell-based assays; single lab with multiple methods","pmids":["11533047"],"is_preprint":false},{"year":2003,"finding":"KA2 (GluK5) homomers are retained in the endoplasmic reticulum (ER) and do not reach the plasma membrane. ER retention is mediated by an arginine-rich ER retention/retrieval motif and a di-leucine endocytic sequence in the KA2 C-terminus. Disruption of both motifs allows KA2 surface expression, but these homomers remain non-functional ion channels. During heteromeric assembly, the ER retention signal is sterically masked, permitting delivery of functional GluR6/KA2 receptors to the plasma membrane.","method":"Surface biotinylation, immunofluorescence, site-directed mutagenesis, electrophysiology in transfected cells and neurons","journal":"The Journal of neuroscience","confidence":"High","confidence_rationale":"Tier 1/2 — multiple orthogonal methods (mutagenesis, biotinylation, imaging, electrophysiology) establishing mechanistic basis of ER retention","pmids":["12878702"],"is_preprint":false},{"year":2003,"finding":"Genetic ablation of KA2 (GluK5, KA2-/-) in mice reduces the agonist affinity of presynaptic facilitatory autoreceptors at mossy-fiber terminals and abolishes heterosynaptic kainate receptor-mediated facilitation driven by glutamate spillover from CA3 collateral synapses. Postsynaptic kainate-mediated EPSCs also show shorter half-decay times in KA2-/- neurons, identifying KA2 as a determinant of both presynaptic and postsynaptic kainate receptor function at mossy-fiber–CA3 synapses.","method":"Hippocampal slice electrophysiology in genetic knockout mice, field and whole-cell recordings","journal":"The Journal of neuroscience","confidence":"High","confidence_rationale":"Tier 2 — clean KO with defined synaptic phenotypes at both pre- and postsynaptic sites","pmids":["12533602"],"is_preprint":false},{"year":2003,"finding":"Co-expression of KA2 with GluR5, GluR6, or GluR7 (but not GluR1 or NMDA receptor NR1) dramatically increases KA2 cell-surface expression in HEK293 cells, indicating a specific assembly requirement. KA2 expressed alone is retained in the ER, while synaptic kainate receptors in native neocortex have relatively high KA2 content compared to microsomal fractions, consistent with synaptic enrichment of KA2-containing heteromers.","method":"Surface biotinylation, cobalt uptake assay, subcellular fractionation of neocortex","journal":"Journal of neurochemistry","confidence":"Medium","confidence_rationale":"Tier 2/3 — biotinylation and functional cobalt uptake in heterologous cells plus fractionation of native tissue","pmids":["12950450"],"is_preprint":false},{"year":2003,"finding":"An ER-retention motif in the KA2 cytosolic C-terminus (containing RRRRR sequence) mediates intracellular retention, but unlike the NMDA receptor NR1 motif, disruption of this arginine stretch alone (by glutamate substitution) is insufficient to relieve ER retention of KA2, indicating a unique and more complex retention mechanism for KA2.","method":"Chimeric reporter protein assay, immunofluorescence, mutagenesis in transfected cells","journal":"Biochemical and biophysical research communications","confidence":"Medium","confidence_rationale":"Tier 3 — single-lab mutagenesis/reporter study; partial mechanistic follow-up","pmids":["14511640"],"is_preprint":false},{"year":2004,"finding":"Intact glutamate binding to the KA2 subunit (threonine 675 in the ligand-binding domain) is required for plasma membrane expression of heteromeric GluR6/KA2 receptors. Mutation of T675 to alanine or glutamate eliminates kainate and glutamate affinity and markedly reduces surface expression of GluR6/KA2 in transfected cells and cultured neurons, even though KA2 T675 mutants still co-assemble with GluR5 and GluR6. This establishes ligand binding as a quality-control checkpoint for forward trafficking of kainate receptors.","method":"Site-directed mutagenesis, surface biotinylation, [3H]kainate binding, immunoprecipitation, pulse-chase degradation assay","journal":"The Journal of biological chemistry","confidence":"High","confidence_rationale":"Tier 1/2 — mutagenesis of specific binding residue combined with multiple trafficking assays; mechanistic quality control checkpoint identified","pmids":["15583001"],"is_preprint":false},{"year":2006,"finding":"COPI vesicle coat proteins mediate ER retention of KA2 by directly interacting with the arginine-rich retention/retrieval determinant in the KA2 cytoplasmic tail. Beta-COP interacts directly with immobilized KA2 peptides containing the arginine-rich signal; alanine substitution of this signal reduces COPI–KA2 association and increases plasma membrane localization. Assembly into GluR6a/KA2 heteromers markedly reduces COPI binding, coinciding with increased association with 14-3-3 proteins that promote forward trafficking.","method":"Co-immunoprecipitation from cerebellum and COS-7 cells, in vitro peptide pulldown, temperature-sensitive COPI degradation, surface localization assay","journal":"The Journal of biological chemistry","confidence":"High","confidence_rationale":"Tier 1/2 — direct peptide interaction, Co-IP in native tissue, functional surface expression readout; mechanistic identification of COPI as ER retention machinery for KA2","pmids":["16595684"],"is_preprint":false},{"year":2006,"finding":"An additional ER retention motif exists in an intracellular loop region of KA2, distinct from the C-terminal motifs. Mutation of both the loop motif and C-terminal motifs together significantly increases KA2 homomeric surface expression beyond mutation of C-terminal motifs alone, but surface-expressed KA2 homomers remain non-functional. In GluR6 knockout mice, native KA2 surface expression is dramatically reduced relative to wild-type, while KA2 trafficking is unaffected in GluR5 knockout mice, demonstrating that GluR6 oligomerization is specifically required for KA2 ER egress in neurons.","method":"Site-directed mutagenesis, surface biotinylation, immunofluorescence, electrophysiology, analysis of GluR5 and GluR6 knockout mice","journal":"The Journal of neuroscience","confidence":"High","confidence_rationale":"Tier 2 — multiple mutagenesis constructs, KO mouse validation, functional electrophysiology; strong evidence for GluR6-specific requirement","pmids":["16807331"],"is_preprint":false},{"year":2008,"finding":"Heteromeric GluR6/KA2 receptors, but not homomeric GluR6 receptors, produce slowly deactivating currents in response to brief glutamate applications with kinetics matching native KAR-EPSCs. Model simulations indicate the slow deactivation of GluR6/KA2 results from stabilization of partially glutamate-bound open states after rapid agonist removal, identifying the KA2 subunit as responsible for the characteristically slow decay of synaptic kainate receptor currents.","method":"Fast glutamate application (piezo-driven) to outside-out patches from transfected cells, kinetic modeling","journal":"The Journal of neuroscience","confidence":"High","confidence_rationale":"Tier 1 — quantitative biophysical characterization combined with Markov model simulation; direct mechanism for slow synaptic KAR kinetics","pmids":["18562611"],"is_preprint":false},{"year":2009,"finding":"Glutamate binding to the ligand-binding domain (LBD) of GluR6 acts as a molecular chaperone for proper folding of nascent kainate receptor subunits in the ER. Mutations that eliminate glutamate binding impair subunit folding and assembly, while mutations that lock the LBD in a closed conformation decrease surface expression and alter oligomeric assembly but do not impair folding. These results establish that LBDs must access multiple conformations (including open and partially closed states) for efficient kainate receptor biogenesis.","method":"Site-directed mutagenesis (including engineered disulfide bridges), surface biotinylation, secretion of soluble LBD proteins, oligomeric assembly analysis","journal":"The Journal of biological chemistry","confidence":"Medium","confidence_rationale":"Tier 2 — mutagenesis with multiple readouts (folding, secretion, PM expression); primarily about GluR6 LBD but directly relevant to KA2/GluK5 heteromeric biogenesis","pmids":["19342380"],"is_preprint":false},{"year":2010,"finding":"The crystal structure of the GluK5 amino-terminal domain (ATD) was solved, revealing that it crystallizes as a dimer with a strikingly different dimer assembly at the R1 interface compared to low-affinity kainate receptor ATDs (GluK1-3). Both R1 and R2 domain dimer assemblies were characterized; the R2 assembly resembles other non-NMDA iGluRs, while the R1 interface is distinct. These structural differences at the R1 dimer interface are consistent with GluK5 being an obligate heteromer that cannot form functional homomeric channels.","method":"X-ray crystallography (high-resolution crystal structure)","journal":"Journal of molecular biology","confidence":"High","confidence_rationale":"Tier 1 — first crystal structure of GluK5 ATD; high-resolution structural data with functional interpretation","pmids":["20951142"],"is_preprint":false},{"year":2009,"finding":"GluK2/GluK5 (GluR6/KA2) heteromeric kainate receptor channels exhibit bell-shaped steady-state concentration-response curves to both glutamate and AMPA, indicating two distinct agonist binding sites with markedly different affinities within the same receptor. The high-affinity site (GluK5) leads to channel opening, while the low-affinity site (GluK2) leads to strong desensitization upon agonist binding. This was confirmed by the GluK2(E738D) mutation, which selectively right-shifted the desensitization phase of the concentration-response curve.","method":"Two-electrode voltage clamp in Xenopus oocytes, site-directed mutagenesis, Markov model fitting","journal":"The Journal of physiology","confidence":"High","confidence_rationale":"Tier 1 — quantitative biophysical characterization with mutagenesis and kinetic modeling; distinct functional roles for GluK2 and GluK5 subunits established","pmids":["20026616"],"is_preprint":false},{"year":2011,"finding":"The GluR6/KA2 ATD assembles as a heterodimer with extremely high affinity (Kd ~11 nM), ~32,000-fold tighter than KA2 ATD homodimer formation. Crystal structures of the GluR6/KA2 ATD heterodimer and heterotetramer assemblies revealed the molecular basis for obligate heteromeric assembly. Mutant cycle analysis confirmed that high-affinity ATD interactions are required for biosynthesis of functional heteromeric receptors.","method":"Sedimentation velocity analytical ultracentrifugation, X-ray crystallography, mutant cycle analysis, electrophysiology","journal":"Neuron","confidence":"High","confidence_rationale":"Tier 1 — crystal structure plus biophysical affinity measurements plus functional mutagenesis; definitive mechanism of obligate heteromeric assembly","pmids":["21791290"],"is_preprint":false},{"year":2012,"finding":"GluK2 and GluK5 subunits assemble with 2:2 stoichiometry in heteromeric kainate receptors at the plasma membrane of live cells, as directly measured by single-molecule imaging with subunit counting. This definitively establishes the tetrameric architecture of GluK2/GluK5 receptors.","method":"Single-molecule fluorescence imaging with step-photobleaching for subunit counting in live cell plasma membranes","journal":"Cell reports","confidence":"High","confidence_rationale":"Tier 1 — direct single-molecule counting in live cells; unambiguous stoichiometry measurement","pmids":["22509486"],"is_preprint":false},{"year":2013,"finding":"CaMKII directly phosphorylates three residues in the C-terminal domain of GluK5 (GRIK5 protein), markedly increasing the lateral mobility of kainate receptors (KARs) at hippocampal mossy fiber synapses, likely by decreasing GluK5 binding to PSD-95. CaMKII activation promotes surface expression of KARs at extrasynaptic sites while simultaneously decreasing synaptic KAR content, mediating long-term depression of KAR-mediated responses (KAR-LTD). Molecular replacement with phosphorylation-deficient GluK5 confirms that direct GluK5 phosphorylation by CaMKII is necessary for KAR-LTD.","method":"In vitro kinase assay, single-particle tracking (lateral mobility), molecular replacement in neurons, hippocampal slice electrophysiology (LTD), Ca2+ imaging","journal":"The EMBO journal","confidence":"High","confidence_rationale":"Tier 1/2 — direct kinase assay identifies phosphorylation sites, single-particle tracking shows functional mobility consequence, molecular replacement confirms necessity; multiple orthogonal methods","pmids":["23288040"],"is_preprint":false},{"year":2013,"finding":"Ligand binding to only the GluK5 subunit (not the GluK2 subunit) is both necessary and sufficient for surface expression of heteromeric GluK2/GluK5 receptors. Mutations that reduce agonist affinity in GluK5 decrease functional heteromeric receptor surface expression and cannot be rescued by wild-type GluK2 or competitive antagonists, while analogous GluK2 mutations can be rescued by co-assembly with wild-type GluK5. This reveals a distinct quality-control role for GluK5 agonist binding in heteromeric KAR trafficking.","method":"Site-directed mutagenesis of ligand-binding domain, electrophysiology, surface expression assays in transfected cells","journal":"Cellular and molecular neurobiology","confidence":"Medium","confidence_rationale":"Tier 2 — mutagenesis with rescue experiments identifying subunit-specific trafficking role; single lab","pmids":["23975096"],"is_preprint":false},{"year":2014,"finding":"Domoate produces a long-lasting inhibition specifically of the GluK5 subunit: brief exposure to domoate prevents GluK5 activation by other agonists for several minutes. In heteromeric GluK2/K5 receptors, the domoate-bound GluK5 state is not a desensitized or blocked conformation, as the receptor can still be fully activated through the GluK2 subunit. A mutation in GluK5 that reduces agonist binding affinity prevents this long-lasting inhibition, establishing its site-specificity.","method":"Whole-cell electrophysiology in transfected cells expressing homomeric and heteromeric kainate receptors, site-directed mutagenesis","journal":"Neuropharmacology","confidence":"Medium","confidence_rationale":"Tier 2 — electrophysiology with mutagenesis defining subunit-specific domoate action; single lab","pmids":["24859608"],"is_preprint":false},{"year":2017,"finding":"GluK5 (encoded by GRIK5) is localized presynaptically to the ribbon synapses of rod photoreceptors in the mouse retina, as shown by double-immunofluorescence and electron microscopy. In GluK5-deficient mice, the structural integrity of synaptic ribbons is severely altered, revealing a novel non-ionotropic function of GluK5 in organizing synaptic ribbons in rod photoreceptor presynaptic terminals.","method":"Immunofluorescence, electron microscopy, GluK5 knockout mouse analysis","journal":"PloS one","confidence":"Medium","confidence_rationale":"Tier 2 — direct localization by EM plus KO mouse structural phenotype; single lab","pmids":["28235022"],"is_preprint":false},{"year":2018,"finding":"Two ER retention signals in the GluK5 C-terminus (an arginine-based signal and a di-leucine motif) are masked not primarily by GluK2 co-assembly but by the scaffold proteins SAP97 and CASK. SAP97 in an extended conformation (facilitated by CASK) engages both its SH3 and GK domains to sterically block the ER retention signals in GluK5. SAP97 and CASK are also required for sorting GluK5-containing receptor complexes into the local dendritic secretory pathway in neurons, revealing that ER retention signals in GluK5 function as dendritic sorting signals rather than simply preventing homomeric export.","method":"Co-immunoprecipitation, in vitro binding, surface expression assays, live-cell imaging of dendritic secretory pathway in neurons, site-directed mutagenesis","journal":"Biochimica et biophysica acta. Molecular cell research","confidence":"Medium","confidence_rationale":"Tier 2 — Co-IP plus functional trafficking assays in neurons; single lab but multiple methods","pmids":["30339823"],"is_preprint":false},{"year":2019,"finding":"Single-molecule FRET reveals that in full-length heteromeric GluK2/GluK5 receptors, GluK2 and GluK5 subunits adopt a specific arrangement within the dimer-of-dimers tetramer, with GluK5 occupying defined positions at the amino-terminal domain interface. The conformational dynamics of both the amino-terminal domain and agonist-binding domain interfaces differ between resting and desensitized states, and these dynamics differ between homomeric and heteromeric receptors, providing insight into how GluK5 incorporation alters gating.","method":"Single-molecule FRET (smFRET) on purified full-length receptors","journal":"Biochimica et biophysica acta. Biomembranes","confidence":"Medium","confidence_rationale":"Tier 1 — smFRET on full-length receptor; novel structural/dynamic data but no mutagenesis validation","pmids":["31194959"],"is_preprint":false},{"year":2019,"finding":"Depletion of the GRIK5 ortholog in zebrafish reduces blood vessel numbers and integrity in the eye and increases vascular permeability, demonstrating a role for GluK5 in vascular biology and eye development beyond classical neurotransmission. Reduced genetically predicted expression of GRIK5 in humans is associated with comorbid vascular and eye diseases in electronic health records.","method":"Zebrafish morpholino knockdown, vascular integrity and permeability assays, electronic health record phenome-wide analysis","journal":"American journal of human genetics","confidence":"Medium","confidence_rationale":"Tier 2/3 — zebrafish KD with defined vascular phenotype; novel non-CNS function; single model system","pmids":["30827500"],"is_preprint":false},{"year":2021,"finding":"GluK5 (GluK5 KO mice on C57BL/6N background) share behavioral phenotypes with GluK2 KO mice including reduced locomotor activity, impaired motor function, and enhanced depressive-like behavior. GluK5 KO mice specifically show enhanced contextual memory, identifying a subunit-specific role for GluK5 in regulating contextual memory encoding and depressive-like behavior.","method":"Behavioral battery in genetic knockout mice (open field, rotarod, forced swim, contextual fear conditioning, etc.)","journal":"Behavioural brain research","confidence":"Medium","confidence_rationale":"Tier 2 — clean KO with defined behavioral phenotypes; first GluK5 KO behavioral characterization on pure genetic background","pmids":["33631192"],"is_preprint":false},{"year":2021,"finding":"GluK1/K5, GluK2/K5, and GluK3/K5 heteromeric kainate receptors can form with either 3:1 or 2:2 stoichiometry as assessed by single-molecule fluorescence, and tri- and tetra-heteromeric KARs containing three or four different subunit types (including GluK5) can be detected. This establishes that GluK5-containing receptors have greater compositional diversity than previously appreciated.","method":"Single-molecule fluorescence imaging (multi-color), single-particle counting in live cells","journal":"Cell reports","confidence":"Medium","confidence_rationale":"Tier 1/2 — single-molecule imaging; direct measurement of stoichiometric flexibility","pmids":["34706237"],"is_preprint":false},{"year":2023,"finding":"In heteromeric GluK2/GluK5 receptors, partial agonism by AMPA is mediated primarily through conformational differences at the GluK2 agonist-binding domain cleft: AMPA binding produces intermediate cleft closure at GluK2 (between apo/open and glutamate/closed states), while the GluK5 agonist-binding domain cleft shows no significant difference between AMPA- and glutamate-bound states. Additionally, the agonist-binding domain dimer interface is not decoupled by AMPA (unlike with full agonist glutamate), establishing distinct subunit contributions to partial agonism.","method":"Single-molecule FRET (smFRET) on full-length GluK2/GluK5 receptors with subunit-specific labeling","journal":"Proteins","confidence":"Medium","confidence_rationale":"Tier 1 — smFRET distinguishing subunit-specific conformational states; mechanistic insight into partial agonism","pmids":["37526035"],"is_preprint":false},{"year":2017,"finding":"Preferential heterodimer formation of GluK5 ATD with GluK1-3 ATDs is energetically favored over GluK5 homodimerization, with heterodimer affinities spanning many orders of magnitude above homodimer stabilities. This thermodynamic framework explains the observed physiological receptor subunit combinations and suggests an assembly pathway in which high-affinity ATD heterodimerization drives GluK5 incorporation into functional heteromers.","method":"Fluorescence-detected sedimentation velocity analytical ultracentrifugation (systematic thermodynamic measurement of homo- and heterodimer affinities)","journal":"eLife","confidence":"High","confidence_rationale":"Tier 1 — rigorous biophysical thermodynamic measurement across multiple subunit combinations; strong mechanistic basis for assembly","pmids":["29058671"],"is_preprint":false},{"year":2008,"finding":"GLIK5 (GLU(K5))-containing kainate receptors tonically reduce the speed of neuroblast migration along the lateral ventricle in the postnatal subventricular zone. Application of GLU(K5) receptor antagonists (NS3763 for homomeric; UB302 for heteromeric GLU(K5)) increased neuroblast migration speed by ~38% in whole-mount preparations, while GLU(K5) activation increased intracellular Ca2+ in ~60% of neuroblasts. This establishes a tonic, non-synaptic role for GluK5-containing receptors in regulating neural progenitor migration.","method":"Whole-mount lateral ventricle preparation with time-lapse imaging, patch-clamp electrophysiology, Ca2+ imaging, selective pharmacological antagonists, RT-PCR from single aspirated cells","journal":"The Journal of physiology","confidence":"Medium","confidence_rationale":"Tier 2 — pharmacological and calcium imaging in native tissue preparation with defined migration phenotype; single lab","pmids":["18565997"],"is_preprint":false},{"year":2007,"finding":"KA2 antisense oligodeoxynucleotide knockdown in vivo reduces expression of both KA2 and GluR6 subunits, suppresses assembly of the GluR6/KA2-PSD95-MLK3 signaling module, inhibits JNK activation and c-jun phosphorylation after cerebral ischemia/reperfusion, and increases neuronal survival in CA1 after 5 days reperfusion. Combined KA2 and GluR6 knockdown has additive neuroprotective effects, establishing functional cooperation between these subunits in activating the PSD95-MLK3-MKK4/7-JNK3 death pathway.","method":"Intracerebroventricular antisense oligodeoxynucleotide infusion, co-immunoprecipitation, immunoblot, neuronal survival counting in rat ischemia model","journal":"Journal of neuroscience research","confidence":"Medium","confidence_rationale":"Tier 3 — antisense knockdown with signaling pathway readout in vivo; mechanistic pathway placement but indirect method","pmids":["17639597"],"is_preprint":false}],"current_model":"GluK5 (GRIK5/KA2) is a high-affinity kainate receptor subunit that cannot form functional homomeric channels because it is retained in the ER via arginine-rich and di-leucine motifs in its C-terminus and an intracellular loop, which are recognized by COPI coat proteins; obligate co-assembly with GluK1-3 subunits (especially GluK6/GluR6 in brain) is required for ER egress — facilitated by 32,000-fold preferred ATD heterodimerization — and GluK5 agonist-site occupancy serves as a quality-control checkpoint for forward trafficking; once at the synapse, GluK5 confers high glutamate affinity, slow deactivation kinetics, AMPA responsiveness, and 2:2 stoichiometry to heteromeric receptors, is clustered and regulated by SAP90/PSD-95 family members (via its C-terminal SH3/GK-binding domain), and undergoes CaMKII-dependent phosphorylation of its C-terminus to drive lateral diffusion away from synapses and KAR long-term depression; additionally, GluK5 has non-canonical roles including presynaptic organization of photoreceptor ribbon synapses and regulation of neuroblast migration and vascular integrity."},"narrative":{"teleology":[{"year":1992,"claim":"The fundamental question of whether KA2 functions as an ion channel was resolved: GluK5 binds kainate with high affinity but requires co-assembly with GluK1–3 subunits to produce functional channels, establishing its obligate heteromeric nature and showing it confers AMPA sensitivity and altered desensitization to heteromers.","evidence":"Heterologous expression in oocytes/HEK cells with electrophysiology and radioligand binding across multiple subunit combinations","pmids":["1373632"],"confidence":"High","gaps":["Stoichiometry of heteromeric assemblies unknown","Mechanism of ER retention not yet addressed","Native receptor composition in specific brain regions undetermined"]},{"year":1994,"claim":"Whether GluK5/GluK2 heteromers exist in native brain was established by reciprocal co-immunoprecipitation from rat brain membranes, confirming the GluR6/KA2 complex as a physiologically relevant entity.","evidence":"Reciprocal co-immunoprecipitation from HEK cells and native rat brain membranes with deglycosylation analysis","pmids":["8288598"],"confidence":"High","gaps":["Subunit stoichiometry within native complexes unknown","Regional and cell-type specificity of heteromer expression not resolved"]},{"year":1996,"claim":"How GluK5 alters the biophysical fingerprint of heteromeric channels was quantified: GluK5 incorporation increases unitary conductance of edited GluK2(R)/GluK5 channels ~2–3-fold, modifies burst kinetics, and confers AMPA sensitivity, explaining functional diversity of native KARs.","evidence":"Single-channel and noise analysis patch-clamp electrophysiology on defined recombinant channels in HEK293 cells","pmids":["8836240","8730589"],"confidence":"High","gaps":["Whether these biophysical properties match native synaptic KAR-EPSCs not yet tested","Structural basis for conductance increase unknown"]},{"year":1997,"claim":"Native KARs in trigeminal ganglion neurons were shown to match recombinant GluR5(R)/KA2 heteromers pharmacologically and kinetically, providing the first strong evidence that GluK5-containing heteromers are the predominant native KAR in a defined neuronal population.","evidence":"RT-PCR plus patch-clamp electrophysiology and pharmacological profiling in acutely dissociated trigeminal neurons","pmids":["9254673"],"confidence":"High","gaps":["Heteromeric identity inferred pharmacologically rather than by direct biochemical isolation from these neurons"]},{"year":1998,"claim":"The scaffolding mechanism linking GluK5 to the postsynaptic density was identified: PSD-95/SAP90 binds GluK5's C-terminus via SH3 and GK domains (not PDZ domains), and this interaction modulates channel desensitization, establishing how GluK5 is anchored and regulated at synapses.","evidence":"Co-immunoprecipitation from neurons, yeast two-hybrid, and electrophysiology in transfected cells","pmids":["9808460"],"confidence":"High","gaps":["Phosphorylation-dependent regulation of this interaction not yet explored","Whether SAP90 binding is required for synaptic localization in vivo untested"]},{"year":2003,"claim":"The mechanism preventing GluK5 homomeric surface expression was dissected: arginine-rich and di-leucine C-terminal motifs plus an intracellular loop signal mediate ER retention; heteromeric assembly masks these signals. In parallel, GluK5 knockout mice revealed that GluK5 sets presynaptic agonist affinity and postsynaptic decay kinetics at mossy fiber–CA3 synapses.","evidence":"Surface biotinylation, mutagenesis, immunofluorescence, electrophysiology in transfected cells and neurons; hippocampal slice electrophysiology in KA2−/− mice","pmids":["12878702","12533602","12950450"],"confidence":"High","gaps":["Identity of the coat protein machinery mediating ER retention not yet known","Role of GluK5 agonist binding in trafficking not addressed"]},{"year":2004,"claim":"A quality-control checkpoint was identified: intact glutamate binding to the GluK5 ligand-binding domain (T675) is required for surface delivery of heteromeric GluK2/GluK5 receptors, even though assembly with GluK2 still occurs, revealing that agonist occupancy at GluK5 gates forward trafficking independently of assembly.","evidence":"Site-directed mutagenesis of binding residue T675, surface biotinylation, radioligand binding, and pulse-chase degradation in transfected cells and neurons","pmids":["15583001"],"confidence":"High","gaps":["Whether endogenous ER glutamate concentration is sufficient for this checkpoint in vivo unknown","ER chaperone partners mediating the checkpoint unidentified"]},{"year":2006,"claim":"The molecular machinery enforcing GluK5 ER retention was identified as COPI vesicle coat proteins, which directly bind the arginine-rich signal; heteromeric assembly displaces COPI and recruits 14-3-3 proteins for forward trafficking. Additionally, GluK6 (not GluK5) knockout specifically abolishes native GluK5 surface expression, confirming GluK2/GluK6 as the obligate partner for ER egress in vivo.","evidence":"Peptide pulldown, co-immunoprecipitation from cerebellum, surface expression assays, analysis of GluR5 and GluR6 KO mice","pmids":["16595684","16807331"],"confidence":"High","gaps":["Whether 14-3-3 binding is phosphorylation-dependent not resolved","Which COPI subunit(s) directly contact the arginine motif not determined at atomic resolution"]},{"year":2008,"claim":"How GluK5 shapes synaptic current kinetics was resolved: GluK2/GluK5 heteromers produce slowly deactivating currents matching native KAR-EPSCs, with kinetic modeling attributing this to stabilization of partially liganded open states by GluK5, directly explaining the characteristically slow KAR-EPSC decay. Separately, GluK5-containing receptors were shown to tonically restrain neuroblast migration speed in the SVZ.","evidence":"Fast glutamate application to outside-out patches with Markov modeling; time-lapse migration imaging and calcium imaging in whole-mount SVZ with selective pharmacology","pmids":["18562611","18565997"],"confidence":"High","gaps":["In vivo confirmation that GluK5 determines KAR-EPSC kinetics at defined synapses beyond mossy fiber–CA3 not shown","Signaling pathway linking GluK5 activation to migration speed regulation unknown"]},{"year":2010,"claim":"Structural determinants of obligate heteromeric assembly were revealed: the GluK5 ATD crystal structure showed a unique R1 dimer interface incompatible with stable homodimerization, and subsequent GluK2/GluK5 ATD heterodimer structures demonstrated ~32,000-fold preferential heterodimerization (Kd ~11 nM), providing the thermodynamic basis for obligate heteromeric assembly.","evidence":"X-ray crystallography of GluK5 ATD homo- and heterodimers; analytical ultracentrifugation measuring homo- vs. heterodimer affinities","pmids":["20951142","21791290"],"confidence":"High","gaps":["Full-length heteromeric receptor structure not yet available","How ATD heterodimerization communicates to transmembrane domain assembly unclear"]},{"year":2012,"claim":"The stoichiometry question was definitively answered: GluK2/GluK5 receptors assemble with 2:2 stoichiometry at the plasma membrane, as measured by single-molecule subunit counting, though later work showed 3:1 stoichiometry and tri/tetra-heteromeric assemblies are also possible.","evidence":"Single-molecule fluorescence photobleaching step-counting in live cells; multi-color single-molecule imaging","pmids":["22509486","34706237"],"confidence":"High","gaps":["Functional consequences of 3:1 vs. 2:2 stoichiometry on channel properties not systematically characterized","Whether stoichiometric flexibility is regulated in vivo unknown"]},{"year":2013,"claim":"A synaptic plasticity mechanism was established: CaMKII directly phosphorylates three GluK5 C-terminal residues, increasing lateral mobility of KARs away from synapses (likely by disrupting PSD-95 binding) and driving KAR long-term depression at mossy fiber synapses—confirmed by molecular replacement with phosphodeficient GluK5.","evidence":"In vitro kinase assay, single-particle tracking of lateral mobility, molecular replacement in neurons, hippocampal slice LTD recordings","pmids":["23288040"],"confidence":"High","gaps":["Identity of the phosphatase(s) reversing CaMKII phosphorylation unknown","Whether this mechanism operates at synapses other than mossy fiber–CA3 not tested"]},{"year":2017,"claim":"A non-ionotropic structural role for GluK5 was discovered: GluK5 localizes presynaptically to rod photoreceptor ribbon synapses, and GluK5 knockout disrupts ribbon synapse architecture, revealing a function independent of postsynaptic glutamate signaling.","evidence":"Double-immunofluorescence and electron microscopy in wild-type and GluK5 KO mouse retina","pmids":["28235022"],"confidence":"Medium","gaps":["Molecular partners mediating GluK5's structural role at ribbons unidentified","Whether this is ion-channel-independent confirmed functionally","Single lab observation"]},{"year":2018,"claim":"The ER retention masking mechanism was refined: SAP97 (in an extended conformation facilitated by CASK) rather than GluK2 co-assembly per se masks the GluK5 C-terminal retention signals, and these signals double as dendritic sorting determinants, reframing ER retention as a targeting mechanism for local dendritic secretory trafficking.","evidence":"Co-immunoprecipitation, in vitro binding, surface expression assays, live-cell imaging of dendritic secretory pathway in neurons","pmids":["30339823"],"confidence":"Medium","gaps":["Relative contributions of SAP97/CASK masking vs. heteromeric assembly masking in vivo not quantified","Whether dendritic sorting is synapse-type specific unknown"]},{"year":2023,"claim":"Subunit-specific conformational dynamics underlying partial agonism were resolved: in GluK2/GluK5 receptors, AMPA produces intermediate cleft closure at GluK2 but not GluK5, and fails to decouple the agonist-binding domain dimer interface, establishing distinct conformational contributions of each subunit to partial vs. full agonism.","evidence":"Single-molecule FRET with subunit-specific labeling on purified full-length GluK2/GluK5 receptors","pmids":["37526035"],"confidence":"Medium","gaps":["Cryo-EM structures of partial vs. full agonist-bound states not available","Whether these conformational differences extend to other partial agonists untested"]},{"year":null,"claim":"Key open questions include: the high-resolution full-length structure of a GluK2/GluK5 heteromeric receptor in defined functional states; the molecular mechanism by which GluK5 organizes photoreceptor ribbon synapses; whether variable stoichiometries (2:2 vs. 3:1) are regulated and functionally distinct in vivo; and how GluK5 contributes to vascular integrity and non-neuronal phenotypes.","evidence":"","pmids":[],"confidence":"Low","gaps":["No full-length heteromeric cryo-EM structure published","Non-ionotropic signaling mechanisms of GluK5 uncharacterized","Vascular phenotype observed only in zebrafish with morpholino knockdown"]}],"mechanism_profile":{"molecular_activity":[{"term_id":"GO:0005215","term_label":"transporter activity","supporting_discovery_ids":[0,4,5,18,21]},{"term_id":"GO:0060089","term_label":"molecular transducer activity","supporting_discovery_ids":[0,21,26]}],"localization":[{"term_id":"GO:0005783","term_label":"endoplasmic reticulum","supporting_discovery_ids":[11,13,14,16,17]},{"term_id":"GO:0005886","term_label":"plasma membrane","supporting_discovery_ids":[3,11,23,32]}],"pathway":[{"term_id":"R-HSA-112316","term_label":"Neuronal System","supporting_discovery_ids":[0,4,12,18,24]},{"term_id":"R-HSA-162582","term_label":"Signal Transduction","supporting_discovery_ids":[24,36]},{"term_id":"R-HSA-9609507","term_label":"Protein localization","supporting_discovery_ids":[11,15,16,17,28]}],"complexes":["GluK2/GluK5 heteromeric kainate receptor","GluK5-PSD-95/SAP90 complex","GluR6/KA2-PSD95-MLK3 signaling module"],"partners":["GRIK2","GRIK1","GRIK3","DLG4","DLG1","CASK","DLG3"],"other_free_text":[]},"mechanistic_narrative":"GRIK5 encodes GluK5 (KA2), a high-affinity kainate receptor subunit that binds kainate with ~15 nM affinity but cannot form functional homomeric channels; it obligately co-assembles with GluK1–3 subunits—preferentially GluK2 in brain—to produce heteromeric receptors with distinct biophysical properties including AMPA responsiveness, slow deactivation kinetics matching native KAR-EPSCs, and bell-shaped concentration-response curves arising from subunit-specific high- and low-affinity agonist sites [PMID:1373632, PMID:18562611, PMID:20026616]. ER retention of GluK5 homomers is enforced by arginine-rich and di-leucine motifs in its C-terminus and an intracellular loop, recognized by COPI coat proteins; heteromeric assembly masks these signals (aided by SAP97/CASK engagement), and ligand occupancy of the GluK5 binding site serves as a quality-control checkpoint for forward trafficking [PMID:12878702, PMID:16595684, PMID:15583001, PMID:30339823]. At synapses, GluK5 is scaffolded by PSD-95 family members via its SH3/GK-binding C-terminal domain, and CaMKII-dependent phosphorylation of three GluK5 C-terminal residues increases lateral receptor mobility and drives kainate receptor long-term depression at mossy fiber–CA3 synapses [PMID:9808460, PMID:23288040]. Beyond ionotropic neurotransmission, GluK5 organizes photoreceptor ribbon synapse architecture, tonically regulates neuroblast migration speed, and contributes to vascular integrity in the eye [PMID:28235022, PMID:18565997, PMID:30827500]."},"prefetch_data":{"uniprot":{"accession":"Q16478","full_name":"Glutamate receptor ionotropic, kainate 5","aliases":["Excitatory amino acid receptor 2","EAA2","Glutamate receptor KA-2","KA2"],"length_aa":980,"mass_kda":109.3,"function":"Ionotropic glutamate receptor that functions as a cation-permeable ligand-gated ion channel, gated by L-glutamate and the glutamatergic agonist kainic acid. Cannot form functional channels on its own and produces channel activity only in heteromeric assembly with GRIK1 and GRIK2 subunits (PubMed:1321949, PubMed:14511640, PubMed:8730589). Can form functional heteromeric receptors with GRIK3 (By similarity)","subcellular_location":"Cell membrane; Postsynaptic cell membrane; Presynaptic cell membrane","url":"https://www.uniprot.org/uniprotkb/Q16478/entry"},"depmap":{"release":"DepMap","has_data":true,"is_common_essential":false,"resolved_as":"","url":"https://depmap.org/portal/gene/GRIK5","classification":"Not Classified","n_dependent_lines":1,"n_total_lines":1208,"dependency_fraction":0.0008278145695364238},"opencell":{"profiled":false,"resolved_as":"","ensg_id":"","cell_line_id":"","localizations":[],"interactors":[],"url":"https://opencell.sf.czbiohub.org/search/GRIK5","total_profiled":1310},"omim":[{"mim_id":"600283","title":"GLUTAMATE RECEPTOR, IONOTROPIC, KAINATE 5; GRIK5","url":"https://www.omim.org/entry/600283"},{"mim_id":"600282","title":"GLUTAMATE RECEPTOR, IONOTROPIC, KAINATE 4; GRIK4","url":"https://www.omim.org/entry/600282"}],"hpa":{"profiled":true,"resolved_as":"","reliability":"Supported","locations":[{"location":"Plasma membrane","reliability":"Supported"},{"location":"Nucleoplasm","reliability":"Additional"}],"tissue_specificity":"Tissue enhanced","tissue_distribution":"Detected in many","driving_tissues":[{"tissue":"brain","ntpm":30.5},{"tissue":"testis","ntpm":31.4}],"url":"https://www.proteinatlas.org/search/GRIK5"},"hgnc":{"alias_symbol":["GluK5","KA2"],"prev_symbol":["GRIK2"]},"alphafold":{"accession":"Q16478","domains":[{"cath_id":"3.40.50.2300","chopping":"22-139_302-343","consensus_level":"high","plddt":83.7127,"start":22,"end":343},{"cath_id":"3.40.50.2300","chopping":"143-269_374-407","consensus_level":"high","plddt":83.7299,"start":143,"end":407},{"cath_id":"3.40.190.10","chopping":"410-521_751-784","consensus_level":"high","plddt":89.5855,"start":410,"end":784},{"cath_id":"1.10.287.70","chopping":"538-645","consensus_level":"high","plddt":85.4174,"start":538,"end":645},{"cath_id":"3.40.190.10","chopping":"649-740","consensus_level":"high","plddt":89.9228,"start":649,"end":740}],"viewer_url":"https://alphafold.ebi.ac.uk/entry/Q16478","model_url":"https://alphafold.ebi.ac.uk/files/AF-Q16478-F1-model_v6.cif","pae_url":"https://alphafold.ebi.ac.uk/files/AF-Q16478-F1-predicted_aligned_error_v6.png","plddt_mean":77.81},"mouse_models":{"mgi_url":"https://www.informatics.jax.org/marker/summary?nomen=GRIK5","jax_strain_url":"https://www.jax.org/strain/search?query=GRIK5"},"sequence":{"accession":"Q16478","fasta_url":"https://rest.uniprot.org/uniprotkb/Q16478.fasta","uniprot_url":"https://www.uniprot.org/uniprotkb/Q16478/entry","alphafold_viewer_url":"https://alphafold.ebi.ac.uk/entry/Q16478"}},"corpus_meta":[{"pmid":"1373632","id":"PMC_1373632","title":"The KA-2 subunit of excitatory amino acid receptors shows widespread expression in brain and forms ion channels with distantly related subunits.","date":"1992","source":"Neuron","url":"https://pubmed.ncbi.nlm.nih.gov/1373632","citation_count":496,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"7852627","id":"PMC_7852627","title":"Histological and ultrastructural localization of the kainate receptor subunits, KA2 and GluR6/7, in the rat nervous system using selective antipeptide antibodies.","date":"1994","source":"The Journal of comparative neurology","url":"https://pubmed.ncbi.nlm.nih.gov/7852627","citation_count":279,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"19339507","id":"PMC_19339507","title":"Arabidopsis protein kinases GRIK1 and GRIK2 specifically activate SnRK1 by phosphorylating its activation loop.","date":"2009","source":"Plant physiology","url":"https://pubmed.ncbi.nlm.nih.gov/19339507","citation_count":143,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"9099808","id":"PMC_9099808","title":"Distribution of kainate receptor subunit mRNAs in human hippocampus, neocortex and cerebellum, and bilateral reduction of hippocampal GluR6 and KA2 transcripts in schizophrenia.","date":"1997","source":"Brain research","url":"https://pubmed.ncbi.nlm.nih.gov/9099808","citation_count":139,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"18332879","id":"PMC_18332879","title":"Evidence for the involvement of the kainate receptor subunit GluR6 (GRIK2) in mediating behavioral displays related to behavioral symptoms of mania.","date":"2008","source":"Molecular psychiatry","url":"https://pubmed.ncbi.nlm.nih.gov/18332879","citation_count":136,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"17847003","id":"PMC_17847003","title":"A defect in the ionotropic glutamate receptor 6 gene (GRIK2) is associated with autosomal recessive mental retardation.","date":"2007","source":"American journal of human genetics","url":"https://pubmed.ncbi.nlm.nih.gov/17847003","citation_count":127,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"12533602","id":"PMC_12533602","title":"Loss of kainate receptor-mediated heterosynaptic facilitation of mossy-fiber synapses in KA2-/- mice.","date":"2003","source":"The Journal of neuroscience : the official journal of the Society for Neuroscience","url":"https://pubmed.ncbi.nlm.nih.gov/12533602","citation_count":127,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"8288598","id":"PMC_8288598","title":"Biochemical and assembly properties of GluR6 and KA2, two members of the kainate receptor family, determined with subunit-specific antibodies.","date":"1994","source":"The Journal of biological chemistry","url":"https://pubmed.ncbi.nlm.nih.gov/8288598","citation_count":108,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"9254673","id":"PMC_9254673","title":"Glutamate receptor subunits GluR5 and KA-2 are coexpressed in rat trigeminal ganglion neurons.","date":"1997","source":"The Journal of neuroscience : the official journal of the Society for Neuroscience","url":"https://pubmed.ncbi.nlm.nih.gov/9254673","citation_count":106,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"12878702","id":"PMC_12878702","title":"Multiple trafficking signals regulate kainate receptor KA2 subunit surface expression.","date":"2003","source":"The Journal of neuroscience : the official journal of the Society for Neuroscience","url":"https://pubmed.ncbi.nlm.nih.gov/12878702","citation_count":101,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"11302154","id":"PMC_11302154","title":"Improvement of desulfurization activity in Rhodococcus erythropolis KA2-5-1 by genetic engineering.","date":"2001","source":"Bioscience, biotechnology, and biochemistry","url":"https://pubmed.ncbi.nlm.nih.gov/11302154","citation_count":63,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"16690725","id":"PMC_16690725","title":"Pharmacological characterization of the competitive GLUK5 receptor antagonist decahydroisoquinoline LY466195 in vitro and in vivo.","date":"2006","source":"The Journal of pharmacology and experimental therapeutics","url":"https://pubmed.ncbi.nlm.nih.gov/16690725","citation_count":60,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"8836240","id":"PMC_8836240","title":"Homomeric and heteromeric ion channels formed from the kainate-type subunits GluR6 and KA2 have very small, but different, unitary conductances.","date":"1996","source":"Journal of neurophysiology","url":"https://pubmed.ncbi.nlm.nih.gov/8836240","citation_count":59,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"17348638","id":"PMC_17348638","title":"Synthesis and pharmacological characterization of N3-substituted willardiine derivatives: role of the substituent at the 5-position of the uracil ring in the development of highly potent and selective GLUK5 kainate receptor antagonists.","date":"2007","source":"Journal of medicinal chemistry","url":"https://pubmed.ncbi.nlm.nih.gov/17348638","citation_count":58,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"16807331","id":"PMC_16807331","title":"Identification of an endoplasmic reticulum-retention motif in an intracellular loop of the kainate receptor subunit KA2.","date":"2006","source":"The Journal of neuroscience : the official journal of the Society for Neuroscience","url":"https://pubmed.ncbi.nlm.nih.gov/16807331","citation_count":57,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"23660601","id":"PMC_23660601","title":"Influence of polymorphisms in genes SLC1A1, GRIN2B, and GRIK2 on clozapine-induced obsessive-compulsive symptoms.","date":"2013","source":"Psychopharmacology","url":"https://pubmed.ncbi.nlm.nih.gov/23660601","citation_count":54,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"21912186","id":"PMC_21912186","title":"Convergent genomic studies identify association of GRIK2 and NPAS2 with chronic fatigue syndrome.","date":"2011","source":"Neuropsychobiology","url":"https://pubmed.ncbi.nlm.nih.gov/21912186","citation_count":52,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"8034316","id":"PMC_8034316","title":"Human GluR6 kainate receptor (GRIK2): molecular cloning, expression, polymorphism, and chromosomal assignment.","date":"1994","source":"Genomics","url":"https://pubmed.ncbi.nlm.nih.gov/8034316","citation_count":49,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"8552236","id":"PMC_8552236","title":"Synaptic expression of the high-affinity kainate receptor subunit KA2 in hippocampal cultures.","date":"1995","source":"Neuroscience","url":"https://pubmed.ncbi.nlm.nih.gov/8552236","citation_count":47,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"18565997","id":"PMC_18565997","title":"Tonic activation of GLUK5 kainate receptors decreases neuroblast migration in whole-mounts of the subventricular zone.","date":"2008","source":"The Journal of physiology","url":"https://pubmed.ncbi.nlm.nih.gov/18565997","citation_count":47,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"22509486","id":"PMC_22509486","title":"Assembly stoichiometry of the GluK2/GluK5 kainate receptor complex.","date":"2012","source":"Cell reports","url":"https://pubmed.ncbi.nlm.nih.gov/22509486","citation_count":45,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"12950450","id":"PMC_12950450","title":"Assembly and cell surface expression of KA-2 subunit-containing kainate receptors.","date":"2003","source":"Journal of neurochemistry","url":"https://pubmed.ncbi.nlm.nih.gov/12950450","citation_count":45,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"8843098","id":"PMC_8843098","title":"The effect of chronic haloperidol treatment on glutamate receptor subunit (GluR1, GluR2, KA1, KA2, NR1) mRNAs and glutamate binding protein mRNA in rat forebrain.","date":"1996","source":"Neuroscience letters","url":"https://pubmed.ncbi.nlm.nih.gov/8843098","citation_count":45,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"23288040","id":"PMC_23288040","title":"CaMKII-dependent phosphorylation of GluK5 mediates plasticity of kainate receptors.","date":"2013","source":"The EMBO journal","url":"https://pubmed.ncbi.nlm.nih.gov/23288040","citation_count":42,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"28180184","id":"PMC_28180184","title":"A gain-of-function mutation in the GRIK2 gene causes neurodevelopmental deficits.","date":"2017","source":"Neurology. Genetics","url":"https://pubmed.ncbi.nlm.nih.gov/28180184","citation_count":41,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"16595684","id":"PMC_16595684","title":"Intracellular trafficking of KA2 kainate receptors mediated by interactions with coatomer protein complex I (COPI) and 14-3-3 chaperone systems.","date":"2006","source":"The Journal of biological chemistry","url":"https://pubmed.ncbi.nlm.nih.gov/16595684","citation_count":41,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"16325263","id":"PMC_16325263","title":"Association study of polymorphisms in the GluR7, KA1 and KA2 kainate receptor genes (GRIK3, GRIK4, GRIK5) with schizophrenia.","date":"2005","source":"Psychiatry research","url":"https://pubmed.ncbi.nlm.nih.gov/16325263","citation_count":40,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"20951142","id":"PMC_20951142","title":"Crystal structures of the glutamate receptor ion channel GluK3 and GluK5 amino-terminal domains.","date":"2010","source":"Journal of molecular biology","url":"https://pubmed.ncbi.nlm.nih.gov/20951142","citation_count":38,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"12069899","id":"PMC_12069899","title":"Characterisation of the effects of ATPA, a GLU(K5) receptor selective agonist, on excitatory synaptic transmission in area CA1 of rat hippocampal slices.","date":"2002","source":"Neuropharmacology","url":"https://pubmed.ncbi.nlm.nih.gov/12069899","citation_count":38,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"12147352","id":"PMC_12147352","title":"A novel enzyme, 2'-hydroxybiphenyl-2-sulfinate desulfinase (DszB), from a dibenzothiophene-desulfurizing bacterium Rhodococcus erythropolis KA2-5-1: gene overexpression and enzyme characterization.","date":"2002","source":"Biochimica et biophysica acta","url":"https://pubmed.ncbi.nlm.nih.gov/12147352","citation_count":37,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"20370803","id":"PMC_20370803","title":"Association between polymorphisms in GRIK2 gene and obsessive-compulsive disorder: a family-based study.","date":"2010","source":"CNS neuroscience & therapeutics","url":"https://pubmed.ncbi.nlm.nih.gov/20370803","citation_count":36,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"34375587","id":"PMC_34375587","title":"Clustered mutations in the GRIK2 kainate receptor subunit gene underlie diverse neurodevelopmental disorders.","date":"2021","source":"American journal of human genetics","url":"https://pubmed.ncbi.nlm.nih.gov/34375587","citation_count":34,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"16232759","id":"PMC_16232759","title":"Increase in desulfurization activity of Rhodococcus erythropolis KA2-5-1 using ethanol feeding.","date":"2000","source":"Journal of bioscience and bioengineering","url":"https://pubmed.ncbi.nlm.nih.gov/16232759","citation_count":33,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"11341322","id":"PMC_11341322","title":"Long-term repeated biodesulfurization by immobilized Rhodococcus erythropolis KA2-5-1 cells.","date":"2001","source":"Applied microbiology and biotechnology","url":"https://pubmed.ncbi.nlm.nih.gov/11341322","citation_count":29,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"11675011","id":"PMC_11675011","title":"Genomic organization of the human GRIK2 gene and evidence for multiple splicing variants.","date":"2001","source":"Gene","url":"https://pubmed.ncbi.nlm.nih.gov/11675011","citation_count":28,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"15305151","id":"PMC_15305151","title":"Maternal transmission disequilibrium of the glutamate receptor GRIK2 in schizophrenia.","date":"2004","source":"Neuroreport","url":"https://pubmed.ncbi.nlm.nih.gov/15305151","citation_count":28,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"30827500","id":"PMC_30827500","title":"GRIK5 Genetically Regulated Expression Associated with Eye and Vascular Phenomes: Discovery through Iteration among Biobanks, Electronic Health Records, and Zebrafish.","date":"2019","source":"American journal of human genetics","url":"https://pubmed.ncbi.nlm.nih.gov/30827500","citation_count":28,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"14511640","id":"PMC_14511640","title":"Trafficking and surface expression of the glutamate receptor subunit, KA2.","date":"2003","source":"Biochemical and biophysical research communications","url":"https://pubmed.ncbi.nlm.nih.gov/14511640","citation_count":27,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"17712621","id":"PMC_17712621","title":"Glutamate receptor 6 gene (GluR6 or GRIK2) polymorphisms in the Indian population: a genetic association study on autism spectrum disorder.","date":"2007","source":"Cellular and molecular neurobiology","url":"https://pubmed.ncbi.nlm.nih.gov/17712621","citation_count":27,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"16837561","id":"PMC_16837561","title":"Antiallodynic and antihyperalgesic effects of selective competitive GLUK5 (GluR5) ionotropic glutamate receptor antagonists in the capsaicin and carrageenan models in rats.","date":"2006","source":"The Journal of pharmacology and experimental therapeutics","url":"https://pubmed.ncbi.nlm.nih.gov/16837561","citation_count":27,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"12375103","id":"PMC_12375103","title":"The cbs mutant strain of Rhodococcus erythropolis KA2-5-1 expresses high levels of Dsz enzymes in the presence of sulfate.","date":"2002","source":"Archives of microbiology","url":"https://pubmed.ncbi.nlm.nih.gov/12375103","citation_count":26,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"17418283","id":"PMC_17418283","title":"Anxiolytic-like effects through a GLUK5 kainate receptor mechanism.","date":"2007","source":"Neuropharmacology","url":"https://pubmed.ncbi.nlm.nih.gov/17418283","citation_count":20,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"7675232","id":"PMC_7675232","title":"Refinement of map position of the human GluR6 kainate receptor gene (GRIK2) and lack of association and linkage with idiopathic generalized epilepsies.","date":"1995","source":"Neurology","url":"https://pubmed.ncbi.nlm.nih.gov/7675232","citation_count":20,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"23037145","id":"PMC_23037145","title":"Association of genes on chromosome 6, GRIK2 , TMEM217 and TMEM63B (linked to MRPL14 ) with diabetic retinopathy.","date":"2012","source":"Ophthalmologica. Journal international d'ophtalmologie. International journal of ophthalmology. Zeitschrift fur Augenheilkunde","url":"https://pubmed.ncbi.nlm.nih.gov/23037145","citation_count":19,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"7527545","id":"PMC_7527545","title":"The genes encoding the glutamate receptor subunits KA1 and KA2 (GRIK4 and GRIK5) are located on separate chromosomes in human, mouse, and rat.","date":"1994","source":"Proceedings of the National Academy of Sciences of the United States of America","url":"https://pubmed.ncbi.nlm.nih.gov/7527545","citation_count":19,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"16153668","id":"PMC_16153668","title":"A pharmacological investigation of the role of GLUK5-containing receptors in kainate-driven hippocampal gamma band oscillations.","date":"2005","source":"Neuropharmacology","url":"https://pubmed.ncbi.nlm.nih.gov/16153668","citation_count":19,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"12467946","id":"PMC_12467946","title":"Association study of polymorphisms in the GluR6 kainate receptor gene (GRIK2) with schizophrenia.","date":"2002","source":"Psychiatry research","url":"https://pubmed.ncbi.nlm.nih.gov/12467946","citation_count":18,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"12012203","id":"PMC_12012203","title":"Developmental distribution of the glutamate receptor subunits KA2, GluR6/7, and delta 1/2 in the rat medial nucleus of the trapezoid body. A quantitative image analysis.","date":"2002","source":"Cell and tissue research","url":"https://pubmed.ncbi.nlm.nih.gov/12012203","citation_count":17,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"15275825","id":"PMC_15275825","title":"Characterisation of the effects of ATPA, a GLU(K5) kainate receptor agonist, on GABAergic synaptic transmission in the CA1 region of rat hippocampal slices.","date":"2004","source":"Neuropharmacology","url":"https://pubmed.ncbi.nlm.nih.gov/15275825","citation_count":17,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"31194959","id":"PMC_31194959","title":"The structural arrangement and dynamics of the heteromeric GluK2/GluK5 kainate receptor as determined by smFRET.","date":"2019","source":"Biochimica et biophysica acta. Biomembranes","url":"https://pubmed.ncbi.nlm.nih.gov/31194959","citation_count":15,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"9079693","id":"PMC_9079693","title":"Gene structure of the rat kainate receptor subunit KA2 and characterization of an intronic negative regulatory region.","date":"1997","source":"The Journal of biological chemistry","url":"https://pubmed.ncbi.nlm.nih.gov/9079693","citation_count":15,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"16233786","id":"PMC_16233786","title":"Effect of sulfur sources on specific desulfurization activity of Rhodococcus erythropolis KA2-5-1 in exponential fed-batch culture.","date":"2005","source":"Journal of bioscience and bioengineering","url":"https://pubmed.ncbi.nlm.nih.gov/16233786","citation_count":15,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"22771793","id":"PMC_22771793","title":"TAA repeat variation in the GRIK2 gene does not influence age at onset in Huntington's disease.","date":"2012","source":"Biochemical and biophysical research communications","url":"https://pubmed.ncbi.nlm.nih.gov/22771793","citation_count":15,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"33631192","id":"PMC_33631192","title":"A comparative analysis of kainate receptor GluK2 and GluK5 knockout mice in a pure genetic background.","date":"2021","source":"Behavioural brain research","url":"https://pubmed.ncbi.nlm.nih.gov/33631192","citation_count":14,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"9271667","id":"PMC_9271667","title":"Rat chromosome 1: regional localization of seven genes (Slc9a3, Srd5a1, Esr, Tcp1, Grik5, Tnnt3, Jak2) and anchoring of the genetic linkage map to the cytogenetic map.","date":"1997","source":"Mammalian genome : official journal of the International Mammalian Genome Society","url":"https://pubmed.ncbi.nlm.nih.gov/9271667","citation_count":14,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"34405274","id":"PMC_34405274","title":"GRIK2 is a target for bladder cancer stem-like cell-targeting immunotherapy.","date":"2021","source":"Cancer immunology, immunotherapy : CII","url":"https://pubmed.ncbi.nlm.nih.gov/34405274","citation_count":14,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"17986771","id":"PMC_17986771","title":"Improvement of 2'-hydroxybiphenyl-2-sulfinate desulfinase, an enzyme involved in the dibenzothiophene desulfurization pathway, from Rhodococcus erythropolis KA2-5-1 by site-directed mutagenesis.","date":"2007","source":"Bioscience, biotechnology, and biochemistry","url":"https://pubmed.ncbi.nlm.nih.gov/17986771","citation_count":14,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"35357273","id":"PMC_35357273","title":"Music alleviates pain perception in depression mouse models by promoting the release of glutamate in the hippocampus of mice to act on GRIK5.","date":"2022","source":"Nucleosides, nucleotides & nucleic acids","url":"https://pubmed.ncbi.nlm.nih.gov/35357273","citation_count":13,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"18046310","id":"PMC_18046310","title":"Activation of kainate GLU(K5) transmission rescues kindling-induced impairment of LTP in the rat lateral amygdala.","date":"2007","source":"Neuropsychopharmacology : official publication of the American College of Neuropsychopharmacology","url":"https://pubmed.ncbi.nlm.nih.gov/18046310","citation_count":13,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"11533047","id":"PMC_11533047","title":"Characterization of the rat GRIK5 kainate receptor subunit gene promoter and its intragenic regions involved in neural cell specificity.","date":"2001","source":"The Journal of biological chemistry","url":"https://pubmed.ncbi.nlm.nih.gov/11533047","citation_count":13,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"8963683","id":"PMC_8963683","title":"Contrasting effects of electroconvulsive shock on mRNAs encoding the high affinity kainate receptor subunits (KA1 and KA2) and cyclophilin in the rat.","date":"1996","source":"Brain research","url":"https://pubmed.ncbi.nlm.nih.gov/8963683","citation_count":12,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"16233332","id":"PMC_16233332","title":"Enhancement and stabilization of desulfurization activity of Rhodococcus erythropolis KA2-5-1 by feeding ethanol and sulfur components.","date":"2002","source":"Journal of bioscience and bioengineering","url":"https://pubmed.ncbi.nlm.nih.gov/16233332","citation_count":11,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"16959037","id":"PMC_16959037","title":"Genetic analysis of the GRIK2 modifier effect in Huntington's disease.","date":"2006","source":"BMC neuroscience","url":"https://pubmed.ncbi.nlm.nih.gov/16959037","citation_count":11,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"39429724","id":"PMC_39429724","title":"A novel AAV9-dual microRNA-vector targeting GRIK2 in the hippocampus as a treatment for mesial temporal lobe epilepsy.","date":"2024","source":"Molecular therapy. Methods & clinical development","url":"https://pubmed.ncbi.nlm.nih.gov/39429724","citation_count":9,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"28235022","id":"PMC_28235022","title":"Presynaptic localization of GluK5 in rod photoreceptors suggests a novel function of high affinity glutamate receptors in the mammalian retina.","date":"2017","source":"PloS one","url":"https://pubmed.ncbi.nlm.nih.gov/28235022","citation_count":9,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"36959746","id":"PMC_36959746","title":"GRIK5 stimulates colon cancer growth and metastasis through cAMP/PKA/CADM3 signaling.","date":"2023","source":"Cell biology international","url":"https://pubmed.ncbi.nlm.nih.gov/36959746","citation_count":8,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"27373850","id":"PMC_27373850","title":"A pharmacological profile of the high-affinity GluK5 kainate receptor.","date":"2016","source":"European journal of pharmacology","url":"https://pubmed.ncbi.nlm.nih.gov/27373850","citation_count":8,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"17639597","id":"PMC_17639597","title":"Functional cooperation between KA2 and GluR6 subunits is involved in the ischemic brain injury.","date":"2007","source":"Journal of neuroscience research","url":"https://pubmed.ncbi.nlm.nih.gov/17639597","citation_count":8,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"16233063","id":"PMC_16233063","title":"Selective cleavage of the two CS bonds in asymmetrically alkylated dibenzothiophenes by Rhodococcus erythropolis KA2-5-1.","date":"2001","source":"Journal of bioscience and bioengineering","url":"https://pubmed.ncbi.nlm.nih.gov/16233063","citation_count":8,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"22489103","id":"PMC_22489103","title":"Synaptic Pattern of KA1 and KA2 upon the Direction-Selective Ganglion Cells in Developing and Adult Mouse Retina.","date":"2012","source":"Acta histochemica et cytochemica","url":"https://pubmed.ncbi.nlm.nih.gov/22489103","citation_count":7,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"23975096","id":"PMC_23975096","title":"Agonist binding to the GluK5 subunit is sufficient for functional surface expression of heteromeric GluK2/GluK5 kainate receptors.","date":"2013","source":"Cellular and molecular neurobiology","url":"https://pubmed.ncbi.nlm.nih.gov/23975096","citation_count":6,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"30587499","id":"PMC_30587499","title":"Isoforms of Ionotropic Glutamate Receptor GRIK2 Induce Senescence of Carcinoma Cells.","date":"2019","source":"Cancer genomics & proteomics","url":"https://pubmed.ncbi.nlm.nih.gov/30587499","citation_count":6,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"31631587","id":"PMC_31631587","title":"Correlation between GRIK2 rs6922753, rs2227283 polymorphism and aggressive behaviors with Bipolar Mania in the Chinese Han population.","date":"2019","source":"Brain and behavior","url":"https://pubmed.ncbi.nlm.nih.gov/31631587","citation_count":6,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"24859608","id":"PMC_24859608","title":"The neurotoxin domoate causes long-lasting inhibition of the kainate receptor GluK5 subunit.","date":"2014","source":"Neuropharmacology","url":"https://pubmed.ncbi.nlm.nih.gov/24859608","citation_count":6,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"15254951","id":"PMC_15254951","title":"Refined linkage to the RDP/DYT12 locus on 19q13.2 and evaluation of GRIK5 as a candidate gene.","date":"2004","source":"Movement disorders : official journal of the Movement Disorder Society","url":"https://pubmed.ncbi.nlm.nih.gov/15254951","citation_count":5,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"32544910","id":"PMC_32544910","title":"Truncated RUNX1 Generated by the Fusion of RUNX1 to Antisense GRIK2 via a Cryptic Chromosome Translocation Enhances Sensitivity to Granulocyte Colony-Stimulating Factor.","date":"2020","source":"Cytogenetic and genome research","url":"https://pubmed.ncbi.nlm.nih.gov/32544910","citation_count":5,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"30339823","id":"PMC_30339823","title":"A novel function for the ER retention signals in the C-terminus of kainate receptor subunit, GluK5.","date":"2018","source":"Biochimica et biophysica acta. Molecular cell research","url":"https://pubmed.ncbi.nlm.nih.gov/30339823","citation_count":4,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"30908586","id":"PMC_30908586","title":"Interaction among GRIK2 gene on epilepsy susceptibility in Chinese children.","date":"2019","source":"Acta neurologica Scandinavica","url":"https://pubmed.ncbi.nlm.nih.gov/30908586","citation_count":3,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"32132452","id":"PMC_32132452","title":"A Novel Susceptibility Locus Near GRIK2 Associated With Erosive Esophagitis in a Korean Cohort.","date":"2020","source":"Clinical and translational gastroenterology","url":"https://pubmed.ncbi.nlm.nih.gov/32132452","citation_count":3,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"33099472","id":"PMC_33099472","title":"Senescence of Normal Human Fibroblasts Relates to the Expression of Ionotropic Glutamate Receptor GluR6/Grik2.","date":"2020","source":"Cancer genomics & proteomics","url":"https://pubmed.ncbi.nlm.nih.gov/33099472","citation_count":2,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"37526035","id":"PMC_37526035","title":"Partial agonism in heteromeric GLUK2/GLUK5 kainate receptor.","date":"2023","source":"Proteins","url":"https://pubmed.ncbi.nlm.nih.gov/37526035","citation_count":2,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"21557188","id":"PMC_21557188","title":"Non-syndromic autosomal recessive mental retardation in Tunisian families : exclusion of GRIK2 and TUSC3 genes.","date":"2011","source":"La Tunisie medicale","url":"https://pubmed.ncbi.nlm.nih.gov/21557188","citation_count":2,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"28900078","id":"PMC_28900078","title":"[Polymorphic Variants of Glutamate Receptor (GRIK5, GRIN2B) and Serotonin Receptor (HTR2A) Genes Are Associated with Chronic Obstructive Pulmonary Disease].","date":"2017","source":"Molekuliarnaia biologiia","url":"https://pubmed.ncbi.nlm.nih.gov/28900078","citation_count":2,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"35328043","id":"PMC_35328043","title":"Alternative Promoters of GRIK2 (GluR6) Gene in Human Carcinoma Cell Lines Are Regulated by Differential Methylation of CpG Dinucleotides.","date":"2022","source":"Genes","url":"https://pubmed.ncbi.nlm.nih.gov/35328043","citation_count":1,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"37990886","id":"PMC_37990886","title":"Epigenetic signature discriminates lymphatic metastasis in BRAF wild-type thyroid carcinoma: methylation role of GRIK2.","date":"2023","source":"Epigenomics","url":"https://pubmed.ncbi.nlm.nih.gov/37990886","citation_count":1,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"41391686","id":"PMC_41391686","title":"Pathological gain-of-function human variants in the GRIK2 kainate receptor gene cause wide-ranging behavioral dysfunction and seizures in mouse models.","date":"2025","source":"Neurobiology of disease","url":"https://pubmed.ncbi.nlm.nih.gov/41391686","citation_count":1,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":"39133077","id":"PMC_39133077","title":"Domoic Acid as a Lead for the Discovery of the First Selective Ligand for Kainate Receptor Subtype 5 (GluK5).","date":"2024","source":"Journal of medicinal chemistry","url":"https://pubmed.ncbi.nlm.nih.gov/39133077","citation_count":0,"is_preprint":false,"source_track":"pubmed_title"},{"pmid":null,"id":"bio_10.1101_2025.09.09.675240","title":"Loss of presenilin 2 function age-dependently increases susceptibility to kainate-induced acute seizures and blunts hippocampal kainate-type glutamate receptor expression","date":"2025-09-11","source":"bioRxiv","url":"https://doi.org/10.1101/2025.09.09.675240","citation_count":0,"is_preprint":true,"source_track":"pubmed_title"},{"pmid":null,"id":"bio_10.1101_2025.08.08.667766","title":"Wide-ranging behavioral dysfunction in two mouse models of pathological human variants in the <i>GRIK2</i> kainate receptor gene","date":"2025-08-08","source":"bioRxiv","url":"https://doi.org/10.1101/2025.08.08.667766","citation_count":0,"is_preprint":true,"source_track":"pubmed_title"},{"pmid":null,"id":"bio_10.1101_2025.11.13.25339504","title":"Trisomy 21 Drives ADARB1 Overexpression and Premature RNA Recoding in the Developing Fetal Brain","date":"2025-11-17","source":"bioRxiv","url":"https://doi.org/10.1101/2025.11.13.25339504","citation_count":0,"is_preprint":true,"source_track":"pubmed_title"},{"pmid":"16169070","id":"PMC_16169070","title":"A human protein-protein interaction network: a resource for annotating the proteome.","date":"2005","source":"Cell","url":"https://pubmed.ncbi.nlm.nih.gov/16169070","citation_count":1704,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"12477932","id":"PMC_12477932","title":"Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences.","date":"2002","source":"Proceedings of the National Academy of Sciences of the United States of America","url":"https://pubmed.ncbi.nlm.nih.gov/12477932","citation_count":1479,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"33961781","id":"PMC_33961781","title":"Dual proteome-scale networks reveal cell-specific remodeling of the human interactome.","date":"2021","source":"Cell","url":"https://pubmed.ncbi.nlm.nih.gov/33961781","citation_count":705,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"21873635","id":"PMC_21873635","title":"Phylogenetic-based propagation of functional annotations within the Gene Ontology consortium.","date":"2011","source":"Briefings in bioinformatics","url":"https://pubmed.ncbi.nlm.nih.gov/21873635","citation_count":656,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"28319085","id":"PMC_28319085","title":"Synergistic drug combinations for cancer identified in a CRISPR screen for pairwise genetic interactions.","date":"2017","source":"Nature biotechnology","url":"https://pubmed.ncbi.nlm.nih.gov/28319085","citation_count":378,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"9808460","id":"PMC_9808460","title":"SAP90 binds and clusters kainate receptors causing incomplete desensitization.","date":"1998","source":"Neuron","url":"https://pubmed.ncbi.nlm.nih.gov/9808460","citation_count":211,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"8730589","id":"PMC_8730589","title":"Effect of RNA editing and subunit co-assembly single-channel properties of recombinant kainate receptors.","date":"1996","source":"The Journal of physiology","url":"https://pubmed.ncbi.nlm.nih.gov/8730589","citation_count":151,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"21791290","id":"PMC_21791290","title":"Structure and assembly mechanism for heteromeric kainate receptors.","date":"2011","source":"Neuron","url":"https://pubmed.ncbi.nlm.nih.gov/21791290","citation_count":99,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"19086053","id":"PMC_19086053","title":"Identification of new putative susceptibility genes for several psychiatric disorders by association analysis of regulatory and non-synonymous SNPs of 306 genes involved in neurotransmission and neurodevelopment.","date":"2009","source":"American journal of medical genetics. Part B, Neuropsychiatric genetics : the official publication of the International Society of Psychiatric Genetics","url":"https://pubmed.ncbi.nlm.nih.gov/19086053","citation_count":81,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"18562611","id":"PMC_18562611","title":"GluR6/KA2 kainate receptors mediate slow-deactivating currents.","date":"2008","source":"The Journal of neuroscience : the official journal of the Society for Neuroscience","url":"https://pubmed.ncbi.nlm.nih.gov/18562611","citation_count":67,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"35256949","id":"PMC_35256949","title":"Histone deacetylase inhibitors inhibit cervical cancer growth through Parkin acetylation-mediated mitophagy.","date":"2021","source":"Acta pharmaceutica Sinica. B","url":"https://pubmed.ncbi.nlm.nih.gov/35256949","citation_count":66,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"11279111","id":"PMC_11279111","title":"Molecular mechanisms regulating the differential association of kainate receptor subunits with SAP90/PSD-95 and SAP97.","date":"2001","source":"The Journal of biological chemistry","url":"https://pubmed.ncbi.nlm.nih.gov/11279111","citation_count":63,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"15583001","id":"PMC_15583001","title":"Ligand binding is a critical requirement for plasma membrane expression of heteromeric kainate receptors.","date":"2004","source":"The Journal of biological chemistry","url":"https://pubmed.ncbi.nlm.nih.gov/15583001","citation_count":52,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"9466455","id":"PMC_9466455","title":"Expression and heteromeric interactions of non-N-methyl-D-aspartate glutamate receptor subunits in the developing and adult cerebellum.","date":"1998","source":"Neuroscience","url":"https://pubmed.ncbi.nlm.nih.gov/9466455","citation_count":47,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"20026616","id":"PMC_20026616","title":"Subunit-specific desensitization of heteromeric kainate receptors.","date":"2009","source":"The Journal of physiology","url":"https://pubmed.ncbi.nlm.nih.gov/20026616","citation_count":39,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"1321949","id":"PMC_1321949","title":"Molecular structure and pharmacological characterization of humEAA2, a novel human kainate receptor subunit.","date":"1992","source":"Molecular pharmacology","url":"https://pubmed.ncbi.nlm.nih.gov/1321949","citation_count":38,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"29955894","id":"PMC_29955894","title":"KAP1 facilitates reinstatement of heterochromatin after DNA replication.","date":"2018","source":"Nucleic acids research","url":"https://pubmed.ncbi.nlm.nih.gov/29955894","citation_count":37,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"29676528","id":"PMC_29676528","title":"E3 ubiquitin ligase RNF123 targets lamin B1 and lamin-binding proteins.","date":"2018","source":"The FEBS journal","url":"https://pubmed.ncbi.nlm.nih.gov/29676528","citation_count":33,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"18247129","id":"PMC_18247129","title":"Human herpesvirus 6 (HHV-6) induces dysregulation of glutamate uptake and transporter expression in astrocytes.","date":"2007","source":"Journal of neuroimmune pharmacology : the official journal of the Society on NeuroImmune Pharmacology","url":"https://pubmed.ncbi.nlm.nih.gov/18247129","citation_count":30,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"12573530","id":"PMC_12573530","title":"Heteromer formation of delta2 glutamate receptors with AMPA or kainate receptors.","date":"2003","source":"Brain research. Molecular brain research","url":"https://pubmed.ncbi.nlm.nih.gov/12573530","citation_count":29,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"21771265","id":"PMC_21771265","title":"Genome-wide association study on bipolar disorder in the Bulgarian population.","date":"2011","source":"Genes, brain, and behavior","url":"https://pubmed.ncbi.nlm.nih.gov/21771265","citation_count":28,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"34706237","id":"PMC_34706237","title":"Structural and compositional diversity in the kainate receptor family.","date":"2021","source":"Cell reports","url":"https://pubmed.ncbi.nlm.nih.gov/34706237","citation_count":28,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"29058671","id":"PMC_29058671","title":"Preferential assembly of heteromeric kainate and AMPA receptor amino terminal domains.","date":"2017","source":"eLife","url":"https://pubmed.ncbi.nlm.nih.gov/29058671","citation_count":27,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"19342380","id":"PMC_19342380","title":"Glutamate binding and conformational flexibility of ligand-binding domains are critical early determinants of efficient kainate receptor biogenesis.","date":"2009","source":"The Journal of biological chemistry","url":"https://pubmed.ncbi.nlm.nih.gov/19342380","citation_count":26,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"34100982","id":"PMC_34100982","title":"Splicing and editing of ionotropic glutamate receptors: a comprehensive analysis based on human RNA-Seq data.","date":"2021","source":"Cellular and molecular life sciences : CMLS","url":"https://pubmed.ncbi.nlm.nih.gov/34100982","citation_count":24,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"19125103","id":"PMC_19125103","title":"Association analysis of the glutamic acid decarboxylase 2 and the glutamine synthetase genes (GAD2, GLUL) with schizophrenia.","date":"2009","source":"Psychiatric genetics","url":"https://pubmed.ncbi.nlm.nih.gov/19125103","citation_count":8,"is_preprint":false,"source_track":"gene2pubmed"},{"pmid":"9039653","id":"PMC_9039653","title":"Kainate/AMPA receptors expressed on human fetal astrocytes in long-term culture.","date":"1997","source":"Journal of neuroscience research","url":"https://pubmed.ncbi.nlm.nih.gov/9039653","citation_count":8,"is_preprint":false,"source_track":"gene2pubmed"}],"cost":{"stage1":{"model":"claude-sonnet-4-6","input_tokens":45269,"output_tokens":6224,"usd":0.114584},"stage2":{"model":"claude-opus-4-6","input_tokens":9825,"output_tokens":3476,"usd":0.204038},"total_usd":0.751609,"stage1_batch_id":"msgbatch_01DzrsgVgYngY1hvM3DU1yF2","stage2_batch_id":"msgbatch_01KA9b7iRzKFdhoBUT7vCvSe","note":"batch pricing = 50% of standard","round2_stage1":{"model":"claude-sonnet-4-6","input_tokens":57873,"output_tokens":10659,"usd":0.166752},"round2_rules_fired":"R2","round2_stage2":{"model":"claude-opus-4-6","input_tokens":14208,"output_tokens":4258,"usd":0.266235}},"stage1_raw":"```json\n{\n  \"discoveries\": [\n    {\n      \"year\": 1992,\n      \"finding\": \"KA-2 (GRIK5) does not form functional homomeric channels when expressed alone, but co-expression with GluR5 or GluR6 subunits produces agonist-gated ion channels; heteromeric GluR5(R)/KA-2 channels show rapid desensitization and altered current-voltage relations compared to GluR5(Q) homomers, and GluR6/KA-2 channels respond to AMPA while homomeric GluR6 does not.\",\n      \"method\": \"Heterologous expression in Xenopus oocytes/HEK cells with electrophysiological recording\",\n      \"journal\": \"Neuron\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1 — functional reconstitution with electrophysiology, foundational study replicated across labs\",\n      \"pmids\": [\"1373632\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 1994,\n      \"finding\": \"KA2 (GRIK5) and GluR6 subunits co-assemble into heteromeric receptor complexes; co-immunoprecipitation from co-transfected cells and rat brain membranes demonstrated their physical association. KA2 is a 123 kDa glycoprotein (deglycosylated 109 kDa). Antibodies to KA2 selectively immunoprecipitated [3H]kainate but not AMPA binding activity.\",\n      \"method\": \"Co-immunoprecipitation from transfected HEK cells and rat brain membranes; immunoblot with deglycosylation; radioligand binding\",\n      \"journal\": \"The Journal of biological chemistry\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1-2 — reciprocal co-IP from both heterologous and native systems, multiple orthogonal methods\",\n      \"pmids\": [\"8288598\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 1994,\n      \"finding\": \"KA2 (GRIK5) protein is postsynaptically localized at ultrastructural level in hippocampus, cerebral cortex, and cerebellar cortex, predominantly in postsynaptic densities apposed to glutamatergic terminals.\",\n      \"method\": \"Immunohistochemistry with affinity-purified antibody; electron microscopy\",\n      \"journal\": \"The Journal of comparative neurology\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 2 — direct ultrastructural localization with subunit-specific antibody\",\n      \"pmids\": [\"7852627\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 1995,\n      \"finding\": \"KA2 (GRIK5) is enriched in dendritic spines of hippocampal neurons and co-localizes with synaptophysin, indicating synaptic localization; however, co-immunoprecipitation showed no direct interaction between KA2 and AMPA receptor subunits GluR1 or GluR2/3, indicating they do not co-assemble into mixed complexes.\",\n      \"method\": \"Immunocytochemistry in cultured hippocampal neurons; co-immunoprecipitation\",\n      \"journal\": \"Neuroscience\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 2 — direct localization with functional implication plus co-IP negative control\",\n      \"pmids\": [\"8552236\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 1996,\n      \"finding\": \"Homomeric GluR6(R) channels have a unitary conductance of ~231-264 fS (femtosiemen range), while heteromeric GluR6(R)/KA2 channels have a ~572 fS conductance (2-3 fold larger); KA2 incorporation also shifts KA EC50 and enables AMPA to gate the heteromeric receptor.\",\n      \"method\": \"Noise analysis of whole-cell and outside-out patch recordings from transfected HEK293 cells\",\n      \"journal\": \"Journal of neurophysiology\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1 — quantitative single-channel biophysics in heterologous system, defines KA2 functional contribution\",\n      \"pmids\": [\"8836240\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 1997,\n      \"finding\": \"GluR5 and KA-2 subunits are co-expressed in trigeminal ganglion neurons and form native heteromeric channels; pharmacological and biophysical properties of native kainate currents in TG neurons closely match recombinant GluR5(R)/KA-2 heteromers in desensitization, rectification, ion permeability, and conductance.\",\n      \"method\": \"RT-PCR, patch-clamp electrophysiology on acutely dissociated neurons, pharmacological characterization\",\n      \"journal\": \"The Journal of neuroscience\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1-2 — multiple orthogonal methods (RT-PCR, pharmacology, electrophysiology) matching native and recombinant properties\",\n      \"pmids\": [\"9254673\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 1997,\n      \"finding\": \"The rat GRIK5 gene contains a first-intron negative regulatory element (silencer) within 500 bp of the 3'-end of intron 1 that inhibits transcription in an orientation- and distance-independent manner; a 24-nucleotide sequence (CTTTCTGTGGCCTCTGACCTTTCC) was identified as the nuclear protein binding site by footprinting and gel shift assays.\",\n      \"method\": \"Reporter gene (CAT) assays, gel shift and footprinting assays with nuclear extracts\",\n      \"journal\": \"The Journal of biological chemistry\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 1-2 — functional reporter assays plus gel shift with defined sequence, single lab\",\n      \"pmids\": [\"9079693\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2001,\n      \"finding\": \"The GRIK5 promoter is TATA-less and GC-rich; 4 kb of 5'-flanking sequence drives CNS-predominant reporter expression in transgenic mice; neural cell-specific transcription involves a TFII-D complex on an initiator element 1100 bp upstream of the first intron; a 77-bp intragenic sequence within the first exon functions as a silencer in non-neural cells via an SP1 site and a neuron-restrictive silencer-like element.\",\n      \"method\": \"Transgenic reporter mice (lacZ), transfection reporter assays, EMSA\",\n      \"journal\": \"The Journal of biological chemistry\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 1-2 — in vivo transgenic validation plus in vitro dissection, single lab\",\n      \"pmids\": [\"11533047\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2003,\n      \"finding\": \"KA2 (GRIK5) homomeric receptors are retained in the endoplasmic reticulum due to an arginine-rich ER retention/retrieval motif and a di-leucine endocytic sequence in the C-terminus; disruption of these motifs allows ER exit and plasma membrane expression but the surface KA2 homomers remain non-functional channels; ER retention signal is sterically shielded upon heteromeric assembly with GluR5-7, enabling delivery of functional heteromeric receptors to the plasma membrane.\",\n      \"method\": \"Biotinylation surface expression assay, site-directed mutagenesis, immunofluorescence, heterologous expression in HEK293 cells and primary neurons\",\n      \"journal\": \"The Journal of neuroscience\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1-2 — multiple orthogonal methods (mutagenesis, surface biotinylation, electrophysiology), replicated in neurons\",\n      \"pmids\": [\"12878702\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2003,\n      \"finding\": \"KA2 (GRIK5) requires co-assembly with GluR5, GluR6, or GluR7 (but not GluR1 or NR1) for surface expression; synaptic KARs in neocortex have relatively higher KA-2 content compared to microsomal fractions.\",\n      \"method\": \"Surface biotinylation, cobalt uptake assay, subcellular fractionation in HEK293 cells and neocortex\",\n      \"journal\": \"Journal of neurochemistry\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 2 — multiple assays (biotinylation, Co2+ uptake), subunit specificity defined\",\n      \"pmids\": [\"12950450\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2003,\n      \"finding\": \"Genetic ablation of KA2 (GRIK5) in mice abolishes heterosynaptic kainate receptor-mediated facilitation at mossy fiber-CA3 synapses; KA2 knockout reduces agonist affinity of presynaptic facilitatory autoreceptors and shortens the half-decay of postsynaptic kainate EPSCs, identifying KA2 as a key determinant of kainate receptor function at both pre- and postsynaptic sites.\",\n      \"method\": \"Hippocampal slice electrophysiology in KA2-/- knockout mice, synaptic physiology recordings\",\n      \"journal\": \"The Journal of neuroscience\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 2 — clean KO with defined synaptic phenotype at both pre- and postsynaptic sites, well-replicated paradigm\",\n      \"pmids\": [\"12533602\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2003,\n      \"finding\": \"The C-terminal arginine-rich motif (RRRRR) of KA2 (GRIK5) is not sufficient alone for ER retention; co-expression with GluR6 disrupts ER retention of KA2 and enables plasma membrane expression, suggesting a GluR6-dependent masking mechanism distinct from the NR1 RRR motif.\",\n      \"method\": \"Chimeric reporter protein trafficking assay, co-expression in HEK cells, immunofluorescence\",\n      \"journal\": \"Biochemical and biophysical research communications\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 3 — single Co-IP/trafficking study, partial mechanistic follow-up\",\n      \"pmids\": [\"14511640\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2006,\n      \"finding\": \"An additional ER retention motif in the intracellular loop of KA2 (GRIK5), distinct from C-terminal motifs, was identified; mutation of all ER retention motifs together increases surface expression but homomeric KA2 remains non-functional; in GluR6 knockout mice, native KA2 surface expression is dramatically reduced, while GluR5 KO does not affect KA2 trafficking, demonstrating that GluR6 oligomerization is required for KA2 ER egress and transport to the cell surface.\",\n      \"method\": \"Site-directed mutagenesis, surface biotinylation, electrophysiology, analysis of GluR6 and GluR5 knockout mouse tissue\",\n      \"journal\": \"The Journal of neuroscience\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1-2 — mutagenesis, in vivo knockout validation, multiple orthogonal methods, clean mechanistic dissection\",\n      \"pmids\": [\"16807331\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2006,\n      \"finding\": \"COPI vesicle coat proteins mediate ER retention of KA2 (GRIK5): beta-COP directly interacts with the arginine-rich retention/retrieval determinant in the KA2 C-tail; alanine substitution of this signal reduces COPI binding; assembly into GluR6a/KA2 heteromers markedly reduces COPI association and concomitantly increases 14-3-3 protein binding, which mediates forward trafficking.\",\n      \"method\": \"Co-immunoprecipitation from cerebellum and COS-7 cells, peptide pulldown, temperature-sensitive COPI degradation, surface localization assay\",\n      \"journal\": \"The Journal of biological chemistry\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1-2 — direct peptide binding, IP from native tissue, mutant analysis, mechanistic sequence defined\",\n      \"pmids\": [\"16595684\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2010,\n      \"finding\": \"Crystal structures of GluK5 (GRIK5) amino-terminal domain (ATD) were determined at high resolution; GluK5 ATD crystallizes as a dimer with a strikingly different dimer assembly at the R1 interface compared to low-affinity subunits (GluK1-3), while the R2 domain dimer assembly is similar to other non-NMDA iGluRs; this structural difference is consistent with GluK5 inability to form functional homomers and its requirement for obligate co-assembly with GluK1-3.\",\n      \"method\": \"X-ray crystallography\",\n      \"journal\": \"Journal of molecular biology\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1 — crystal structure with functional interpretation, direct structural evidence\",\n      \"pmids\": [\"20951142\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2012,\n      \"finding\": \"GluK2 and GluK5 (GRIK5) subunits assemble with strict 2:2 stoichiometry within the tetrameric receptor complex, as demonstrated by single-molecule subunit counting in live-cell plasma membranes.\",\n      \"method\": \"Single-molecule imaging with fluorescent protein-tagged subunits and step-photobleaching counting in live cell membranes\",\n      \"journal\": \"Cell reports\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1 — single-molecule reconstitution in live cells with direct subunit counting, novel quantitative method\",\n      \"pmids\": [\"22509486\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2013,\n      \"finding\": \"CaMKII phosphorylates three residues in the C-terminal domain of GluK5 (GRIK5); this phosphorylation markedly increases lateral mobility of KARs, likely by decreasing GluK5 binding to PSD-95, promotes surface expression at extrasynaptic sites, and decreases synaptic content, resulting in long-term depression of KAR-mediated responses at hippocampal mossy fiber synapses (KAR-LTD). Molecular replacement demonstrated that direct GluK5 phosphorylation by CaMKII is necessary for KAR-LTD.\",\n      \"method\": \"In vitro CaMKII phosphorylation assay, single-particle tracking/FRAP, electrophysiology in hippocampal slices, molecular replacement strategy in neurons\",\n      \"journal\": \"The EMBO journal\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1-2 — in vitro kinase assay, molecular replacement, live-cell tracking, and slice electrophysiology; multiple orthogonal methods\",\n      \"pmids\": [\"23288040\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2013,\n      \"finding\": \"Agonist binding to the GluK5 subunit (not GluK2) is both necessary and sufficient for surface trafficking of heteromeric GluK2/GluK5 receptors; mutation of the S2 ligand-binding domain in GluK5 prevents functional heteromeric surface expression and cannot be rescued by wild-type GluK2 or antagonist, whereas GluK2 site mutations can be rescued by wild-type GluK5.\",\n      \"method\": \"Site-directed mutagenesis, heterologous expression, electrophysiology, surface expression assay\",\n      \"journal\": \"Cellular and molecular neurobiology\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 2 — clean mutagenesis with functional rescue experiments, single lab\",\n      \"pmids\": [\"23975096\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2014,\n      \"finding\": \"Domoate causes long-lasting inhibition of the GluK5 subunit in heteromeric GluK2/GluK5 receptors: brief exposure to domoate prevents GluK5 activation by other agonists for several minutes; a mutation reducing agonist binding affinity in GluK5 prevents this effect; GluK2 subunits can independently gate the ion channel in domoate-bound GluK2/GluK5 heteromers, demonstrating functional independence of subunits within the tetramer.\",\n      \"method\": \"Electrophysiology in heterologous cells, site-directed mutagenesis of GluK5 agonist-binding domain\",\n      \"journal\": \"Neuropharmacology\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 2 — mutagenesis plus electrophysiology defining subunit-specific mechanism, single lab\",\n      \"pmids\": [\"24859608\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2017,\n      \"finding\": \"GluK5 (GRIK5) is presynaptically localized to the ribbon of rod photoreceptor terminals in the mouse retina; in GluK5-deficient mice, structural integrity of synaptic ribbons is severely altered, indicating a role for GluK5 in organizing presynaptic ribbon structure.\",\n      \"method\": \"Double-immunofluorescence, electron microscopy, analysis of GluK5 knockout mouse retina\",\n      \"journal\": \"PloS one\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 2 — direct ultrastructural localization with KO phenotype, single lab\",\n      \"pmids\": [\"28235022\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2018,\n      \"finding\": \"GluK5 (GRIK5) has two ER retention signals in its cytoplasmic C-terminus (arginine-based and di-leucine); these are not blocked by GluK2 co-assembly alone but are sterically masked by binding of SAP97 (in extended conformation) and CASK; SAP97's SH3 and GuK domains interact directly with each ER retention signal in the presence of CASK; SAP97 and CASK are required for sorting KAR complexes into the local dendritic secretory pathway in neurons.\",\n      \"method\": \"Co-immunoprecipitation, FRET/conformational analysis, mutagenesis, neuronal trafficking assays\",\n      \"journal\": \"Biochimica et biophysica acta. Molecular cell research\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 2 — direct binding assays plus neuronal trafficking experiments, single lab with multiple methods\",\n      \"pmids\": [\"30339823\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2019,\n      \"finding\": \"The arrangement of GluK2 and GluK5 subunits within full-length heteromeric receptors was determined by smFRET: they occupy defined positions in the dimer-of-dimers configuration; conformational dynamics of the agonist-binding domain and amino-terminal domain interfaces differ between resting and desensitized states in heteromeric versus homomeric receptors.\",\n      \"method\": \"Single-molecule FRET on full-length receptors\",\n      \"journal\": \"Biochimica et biophysica acta. Biomembranes\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 1 — smFRET on full-length receptor, single lab\",\n      \"pmids\": [\"31194959\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2019,\n      \"finding\": \"Depletion of GRIK5 ortholog in zebrafish reduces blood vessel numbers and integrity in the eye and increases vascular permeability, linking GRIK5 to vascular biology in the context of eye disease.\",\n      \"method\": \"Morpholino knockdown in zebrafish; vascular imaging\",\n      \"journal\": \"American journal of human genetics\",\n      \"confidence\": \"Low\",\n      \"confidence_rationale\": \"Tier 3 — zebrafish KD phenotype, no molecular mechanism defined\",\n      \"pmids\": [\"30827500\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2021,\n      \"finding\": \"GluK5 (GRIK5) knockout mice exhibit reduced locomotor activity, impaired motor function, and enhanced depressive-like behavior, as well as subunit-specific enhancement of contextual memory; GluK2 and GluK5 subunits function both coordinately and with subunit-specific roles in behavior.\",\n      \"method\": \"Behavioral analysis of GluK5 KO mice on C57BL/6N background\",\n      \"journal\": \"Behavioural brain research\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 2 — clean KO with defined behavioral phenotypes across multiple tests, single lab\",\n      \"pmids\": [\"33631192\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2023,\n      \"finding\": \"In heteromeric GluK2/GluK5 receptors, partial agonism by AMPA is mediated primarily by the GluK2 subunit: AMPA occupies intermediate cleft-closure conformations at the GluK2 agonist-binding domain, while the GluK5 agonist-binding domain shows no significant conformational difference between partial agonist (AMPA) and full agonist (glutamate) states; the dimer interface at the agonist-binding domain is not decoupled in the AMPA-bound state.\",\n      \"method\": \"Single-molecule FRET on GluK2/GluK5 heteromeric receptors\",\n      \"journal\": \"Proteins\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 1 — smFRET with defined conformational states, single lab\",\n      \"pmids\": [\"37526035\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2007,\n      \"finding\": \"KA2 (GRIK5) knockdown with antisense oligodeoxynucleotides in vivo reduces both KA2 and GluR6 expression, suppresses assembly of the GluR6/KA2-PSD95-MLK3 signaling module, inhibits JNK activation and c-jun phosphorylation, and increases neuronal survival after cerebral ischemia; combined KA2 and GluR6 knockdown has additive neuroprotective effects.\",\n      \"method\": \"Intracerebroventricular antisense oligodeoxynucleotide infusion, immunoprecipitation, western blot, histological survival assessment in rat ischemia model\",\n      \"journal\": \"Journal of neuroscience research\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 2 — in vivo KD with defined signaling readout and cell death assay, single lab\",\n      \"pmids\": [\"17639597\"],\n      \"is_preprint\": false\n    }\n  ],\n  \"current_model\": \"GRIK5 (KA2/GluK5) is a high-affinity kainate receptor subunit that cannot form functional homomeric channels due to ER retention signals in its C-terminus and intracellular loop—masked by COPI binding—but obligately co-assembles with GluK1-3 subunits (especially GluK2/GluR6) in a 2:2 stoichiometry to form functional heteromeric ion channels; GluK5 ligand-binding domain occupancy is the rate-limiting step for heteromer surface trafficking, the subunit contributes unique biophysical properties (higher conductance, AMPA sensitivity) and a distinct agonist-binding mechanism, and it undergoes CaMKII-dependent phosphorylation on its C-terminal domain that drives lateral diffusion and synaptic depression (KAR-LTD) by reducing PSD-95 interaction.\"\n}\n```\n\n--- ROUND 2 (R2/R3, augmented corpus) ---\n\nI'll systematically classify each paper, then extract mechanistic discoveries only from KEEP papers about GRIK5 (encoding the KA2/GluK5 kainate receptor subunit).\n\n**Key exclusions:**\n- Papers about GRIK2 (GluK2/GluR6) only → EXCLUDE (alias collision with different gene)\n- Papers about Rhodococcus erythropolis KA2-5-1 (bacterial strain name) → EXCLUDE (symbol collision)\n- Papers about Arabidopsis GRIK1/GRIK2 (plant kinases) → EXCLUDE (symbol collision)\n- Papers that are pure GWAS/expression/biomarker with no mechanism → EXCLUDE\n\n**KEEP papers** (about GRIK5/KA2/GluK5 canonical protein):\n- PMID 1373632, 7852627, 8288598, 9254673, 12878702, 16807331, 16595684, 12533602, 8836240, 22509486, 20951142, 31194959, 9079693, 11533047, 9808460, 11279111, 15583001, 8730589, 21791290, 23288040, 16690725, 19339507 (EXCLUDE - Arabidopsis), 18565997, 28235022, 30339823, 23975096, 24859608, 19342380, 34706237, 29058671, 20026616, 37526035, 8552236, 12950450, 14511640, 16959037 (EXCLUDE - HD modifier only), 30827500, 37990886 (EXCLUDE - methylation/cancer), 36959746 (GRIK5 in colon cancer - mechanism claimed via cAMP/PKA), 35357273, 33631192 (behavioral KO study), 16153668, 18046310, 16325263 (EXCLUDE - association only), 7527545 (chromosomal mapping - keep for localization), 15254951 (EXCLUDE - candidate gene, no mutations found)\n\nLet me focus on clearly mechanistic papers:\n\n```json\n{\n  \"discoveries\": [\n    {\n      \"year\": 1992,\n      \"finding\": \"GluK5 (KA-2) binds [3H]kainate with high affinity (KD ~15 nM) but does not form functional homomeric channels; coexpression with GluR5(R) or GluR6 subunits produces agonist-gated currents, demonstrating that GluK5 requires heteromeric assembly with low-affinity subunits for channel function. Heteromeric GluR5(Q)/KA-2 channels show more rapid desensitization and altered current-voltage relations compared to GluR5(Q) homomers, and GluR6/KA-2 channels gain responsiveness to AMPA.\",\n      \"method\": \"Heterologous expression in Xenopus oocytes/HEK cells, electrophysiology, radioligand binding\",\n      \"journal\": \"Neuron\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1 — reconstitution in heterologous system with multiple subunit combinations; foundational study replicated extensively\",\n      \"pmids\": [\"1373632\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 1994,\n      \"finding\": \"GluK5 (KA2) and GluR6 subunits co-assemble into heteromeric complexes in transfected HEK cells and in native rat brain membranes, as demonstrated by reciprocal co-immunoprecipitation. KA2 runs at ~123 kDa (glycosylated) and ~109 kDa (deglycosylated), confirming it is a glycoprotein. Antibodies to GluR6 co-immunoprecipitate KA2 and vice versa from detergent-solubilized brain membranes, establishing the GluR6/KA2 heteromeric complex as a native brain entity.\",\n      \"method\": \"Co-immunoprecipitation, immunoblot, deglycosylation assay, [3H]kainate binding\",\n      \"journal\": \"The Journal of biological chemistry\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 2 — reciprocal Co-IP in both heterologous cells and native brain tissue\",\n      \"pmids\": [\"8288598\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 1994,\n      \"finding\": \"GRIK5 (encoding KA2) maps to human chromosome 19q13.2, mouse chromosome 7, and rat chromosome 1, establishing its chromosomal localization as distinct from GRIK4 (KA1) on human chromosome 11q22.3.\",\n      \"method\": \"Southern analysis of somatic cell hybrid panels, fluorescence in situ hybridization, interspecific backcross mapping\",\n      \"journal\": \"Proceedings of the National Academy of Sciences of the United States of America\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 2 — direct FISH and somatic cell hybrid mapping, replicated across species\",\n      \"pmids\": [\"7527545\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 1995,\n      \"finding\": \"KA2 (GluK5) is enriched at synaptic sites in hippocampal neurons, co-localizing with the synaptic vesicle marker synaptophysin in dendritic spines after ~14 days in culture. Despite co-localization with AMPA subunit GluR1 in the same spines, co-immunoprecipitation shows no direct interaction between GluR1 and KA2, confirming that AMPA and kainate receptor complexes remain distinct at synapses.\",\n      \"method\": \"Immunocytochemistry, co-immunoprecipitation in cultured hippocampal neurons\",\n      \"journal\": \"Neuroscience\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 2/3 — direct localization with synaptic marker plus negative Co-IP result; single lab\",\n      \"pmids\": [\"8552236\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 1996,\n      \"finding\": \"Heteromeric GluR6(R)/KA2 channels have a ~2–3-fold larger unitary conductance (~572 fS) than homomeric GluR6(R) channels (~231–264 fS), as measured by noise analysis. GluR6(R)/KA2 heteromers are additionally activated by AMPA (which fails to gate homomeric GluR6), and show higher EC50 for kainate (~1.62 µM) compared to homomers (~0.47 µM).\",\n      \"method\": \"Patch-clamp electrophysiology (whole-cell noise analysis), transfected HEK293 cells\",\n      \"journal\": \"Journal of neurophysiology\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1 — quantitative biophysical characterization of recombinant channels with defined subunit compositions\",\n      \"pmids\": [\"8836240\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 1996,\n      \"finding\": \"RNA editing at the Q/R site of GluR5 and GluR6 dramatically reduces homomeric single-channel conductance. Coexpression of KA2 with GluR5(Q) dramatically shortens channel burst length, while coexpression with edited GluR5(R) or GluR6(R) increases mean single-channel conductance (~950 fS for GluR5(R)/KA2; ~700 fS for GluR6(R)/KA2) relative to the respective homomers.\",\n      \"method\": \"Outside-out patch-clamp single-channel recording and spectral/variance analysis, transfected HEK293 cells\",\n      \"journal\": \"The Journal of physiology\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1 — single-channel biophysics with defined edited/unedited subunit combinations\",\n      \"pmids\": [\"8730589\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 1997,\n      \"finding\": \"In rat trigeminal ganglion (TG) neurons, GluR5 and KA2 mRNAs are co-expressed at high levels, and the pharmacological, kinetic, rectification, and ion-permeability properties of native kainate currents closely match those of recombinant GluR5(R)/KA2 heteromeric channels, providing strong evidence that GluR5/KA2 heteromers are the predominant native kainate receptor in TG neurons.\",\n      \"method\": \"RT-PCR, patch-clamp electrophysiology of acutely dissociated neurons, pharmacological characterization\",\n      \"journal\": \"The Journal of neuroscience\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 2 — multiple orthogonal methods (molecular, electrophysiological, pharmacological) in native neurons\",\n      \"pmids\": [\"9254673\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 1997,\n      \"finding\": \"The rat GRIK5 gene spans >54 kb and is composed of 20 exons. The 5'-flanking region confers tissue-specific expression, and the first intron contains a negative regulatory element (silencer) located within 500 bp of the intron's 3' end that inhibits transcription in an orientation- and distance-independent manner; a 24-nucleotide sequence within this region binds nuclear proteins and mediates silencer activity.\",\n      \"method\": \"Reporter gene (CAT) transfection assay, genomic library screening, footprinting, gel shift assays\",\n      \"journal\": \"The Journal of biological chemistry\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 2 — functional reporter assays with deletion analysis and protein-binding validation; single lab\",\n      \"pmids\": [\"9079693\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 1998,\n      \"finding\": \"SAP90 (PSD-95) and SAP102 co-immunoprecipitate with KA2 (GluK5) from neurons. The KA2 C-terminal region binds specifically to the SH3 and GK domains of SAP90 (not the PDZ domains that bind GluR6). Co-expression of SAP90 with GluR6/KA2 receptors reduces desensitization of kainate-evoked currents, demonstrating that SAP90/PSD-95 family members modulate the electrophysiological properties of KA2-containing kainate receptors.\",\n      \"method\": \"Co-immunoprecipitation, yeast two-hybrid, transfected cell electrophysiology\",\n      \"journal\": \"Neuron\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 2 — Co-IP in neurons plus functional electrophysiological consequence, replicated with multiple SAP family members\",\n      \"pmids\": [\"9808460\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2001,\n      \"finding\": \"The intramolecular interaction of the SAP97 N-terminus with its own SH3 domain occludes the KA2-binding site on SAP97, explaining why SAP97 associates weakly with KA2 in vivo compared to SAP90. The individual SH3 and GK domains of SAP97 can bind KA2's C-terminal tail in vitro, but specific intramolecular contacts in full-length SAP97 prevent this interaction, revealing a mechanism for differential subcellular targeting of kainate receptors by distinct SAP family members.\",\n      \"method\": \"GFP-chimera expression, co-immunoprecipitation in HEK293 cells, in vitro binding assays with deletion mutants\",\n      \"journal\": \"The Journal of biological chemistry\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 2/3 — in vitro binding plus cell expression; mechanistic follow-up of SAP90 paper; single lab\",\n      \"pmids\": [\"11279111\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2001,\n      \"finding\": \"The GRIK5 promoter is TATA-less and GC-rich with multiple initiator sequences. A 1200 bp 5'-flanking region sustains neural cell-specific promoter activity via a TFIID-containing complex at an initiator sequence ~1100 bp upstream of intron 1. A 77-bp intronic/exonic sequence functions as a silencer in non-neural cells, containing a functional SP1-binding site and a neuron-restrictive silencer element-like sequence that suppresses GRIK5 expression in fibroblasts.\",\n      \"method\": \"Transgenic mouse lacZ reporter, reporter transfection assays, gel shift/EMSAs, deletion analysis\",\n      \"journal\": \"The Journal of biological chemistry\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 2 — in vivo transgenic reporter plus cell-based assays; single lab with multiple methods\",\n      \"pmids\": [\"11533047\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2003,\n      \"finding\": \"KA2 (GluK5) homomers are retained in the endoplasmic reticulum (ER) and do not reach the plasma membrane. ER retention is mediated by an arginine-rich ER retention/retrieval motif and a di-leucine endocytic sequence in the KA2 C-terminus. Disruption of both motifs allows KA2 surface expression, but these homomers remain non-functional ion channels. During heteromeric assembly, the ER retention signal is sterically masked, permitting delivery of functional GluR6/KA2 receptors to the plasma membrane.\",\n      \"method\": \"Surface biotinylation, immunofluorescence, site-directed mutagenesis, electrophysiology in transfected cells and neurons\",\n      \"journal\": \"The Journal of neuroscience\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1/2 — multiple orthogonal methods (mutagenesis, biotinylation, imaging, electrophysiology) establishing mechanistic basis of ER retention\",\n      \"pmids\": [\"12878702\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2003,\n      \"finding\": \"Genetic ablation of KA2 (GluK5, KA2-/-) in mice reduces the agonist affinity of presynaptic facilitatory autoreceptors at mossy-fiber terminals and abolishes heterosynaptic kainate receptor-mediated facilitation driven by glutamate spillover from CA3 collateral synapses. Postsynaptic kainate-mediated EPSCs also show shorter half-decay times in KA2-/- neurons, identifying KA2 as a determinant of both presynaptic and postsynaptic kainate receptor function at mossy-fiber–CA3 synapses.\",\n      \"method\": \"Hippocampal slice electrophysiology in genetic knockout mice, field and whole-cell recordings\",\n      \"journal\": \"The Journal of neuroscience\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 2 — clean KO with defined synaptic phenotypes at both pre- and postsynaptic sites\",\n      \"pmids\": [\"12533602\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2003,\n      \"finding\": \"Co-expression of KA2 with GluR5, GluR6, or GluR7 (but not GluR1 or NMDA receptor NR1) dramatically increases KA2 cell-surface expression in HEK293 cells, indicating a specific assembly requirement. KA2 expressed alone is retained in the ER, while synaptic kainate receptors in native neocortex have relatively high KA2 content compared to microsomal fractions, consistent with synaptic enrichment of KA2-containing heteromers.\",\n      \"method\": \"Surface biotinylation, cobalt uptake assay, subcellular fractionation of neocortex\",\n      \"journal\": \"Journal of neurochemistry\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 2/3 — biotinylation and functional cobalt uptake in heterologous cells plus fractionation of native tissue\",\n      \"pmids\": [\"12950450\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2003,\n      \"finding\": \"An ER-retention motif in the KA2 cytosolic C-terminus (containing RRRRR sequence) mediates intracellular retention, but unlike the NMDA receptor NR1 motif, disruption of this arginine stretch alone (by glutamate substitution) is insufficient to relieve ER retention of KA2, indicating a unique and more complex retention mechanism for KA2.\",\n      \"method\": \"Chimeric reporter protein assay, immunofluorescence, mutagenesis in transfected cells\",\n      \"journal\": \"Biochemical and biophysical research communications\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 3 — single-lab mutagenesis/reporter study; partial mechanistic follow-up\",\n      \"pmids\": [\"14511640\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2004,\n      \"finding\": \"Intact glutamate binding to the KA2 subunit (threonine 675 in the ligand-binding domain) is required for plasma membrane expression of heteromeric GluR6/KA2 receptors. Mutation of T675 to alanine or glutamate eliminates kainate and glutamate affinity and markedly reduces surface expression of GluR6/KA2 in transfected cells and cultured neurons, even though KA2 T675 mutants still co-assemble with GluR5 and GluR6. This establishes ligand binding as a quality-control checkpoint for forward trafficking of kainate receptors.\",\n      \"method\": \"Site-directed mutagenesis, surface biotinylation, [3H]kainate binding, immunoprecipitation, pulse-chase degradation assay\",\n      \"journal\": \"The Journal of biological chemistry\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1/2 — mutagenesis of specific binding residue combined with multiple trafficking assays; mechanistic quality control checkpoint identified\",\n      \"pmids\": [\"15583001\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2006,\n      \"finding\": \"COPI vesicle coat proteins mediate ER retention of KA2 by directly interacting with the arginine-rich retention/retrieval determinant in the KA2 cytoplasmic tail. Beta-COP interacts directly with immobilized KA2 peptides containing the arginine-rich signal; alanine substitution of this signal reduces COPI–KA2 association and increases plasma membrane localization. Assembly into GluR6a/KA2 heteromers markedly reduces COPI binding, coinciding with increased association with 14-3-3 proteins that promote forward trafficking.\",\n      \"method\": \"Co-immunoprecipitation from cerebellum and COS-7 cells, in vitro peptide pulldown, temperature-sensitive COPI degradation, surface localization assay\",\n      \"journal\": \"The Journal of biological chemistry\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1/2 — direct peptide interaction, Co-IP in native tissue, functional surface expression readout; mechanistic identification of COPI as ER retention machinery for KA2\",\n      \"pmids\": [\"16595684\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2006,\n      \"finding\": \"An additional ER retention motif exists in an intracellular loop region of KA2, distinct from the C-terminal motifs. Mutation of both the loop motif and C-terminal motifs together significantly increases KA2 homomeric surface expression beyond mutation of C-terminal motifs alone, but surface-expressed KA2 homomers remain non-functional. In GluR6 knockout mice, native KA2 surface expression is dramatically reduced relative to wild-type, while KA2 trafficking is unaffected in GluR5 knockout mice, demonstrating that GluR6 oligomerization is specifically required for KA2 ER egress in neurons.\",\n      \"method\": \"Site-directed mutagenesis, surface biotinylation, immunofluorescence, electrophysiology, analysis of GluR5 and GluR6 knockout mice\",\n      \"journal\": \"The Journal of neuroscience\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 2 — multiple mutagenesis constructs, KO mouse validation, functional electrophysiology; strong evidence for GluR6-specific requirement\",\n      \"pmids\": [\"16807331\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2008,\n      \"finding\": \"Heteromeric GluR6/KA2 receptors, but not homomeric GluR6 receptors, produce slowly deactivating currents in response to brief glutamate applications with kinetics matching native KAR-EPSCs. Model simulations indicate the slow deactivation of GluR6/KA2 results from stabilization of partially glutamate-bound open states after rapid agonist removal, identifying the KA2 subunit as responsible for the characteristically slow decay of synaptic kainate receptor currents.\",\n      \"method\": \"Fast glutamate application (piezo-driven) to outside-out patches from transfected cells, kinetic modeling\",\n      \"journal\": \"The Journal of neuroscience\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1 — quantitative biophysical characterization combined with Markov model simulation; direct mechanism for slow synaptic KAR kinetics\",\n      \"pmids\": [\"18562611\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2009,\n      \"finding\": \"Glutamate binding to the ligand-binding domain (LBD) of GluR6 acts as a molecular chaperone for proper folding of nascent kainate receptor subunits in the ER. Mutations that eliminate glutamate binding impair subunit folding and assembly, while mutations that lock the LBD in a closed conformation decrease surface expression and alter oligomeric assembly but do not impair folding. These results establish that LBDs must access multiple conformations (including open and partially closed states) for efficient kainate receptor biogenesis.\",\n      \"method\": \"Site-directed mutagenesis (including engineered disulfide bridges), surface biotinylation, secretion of soluble LBD proteins, oligomeric assembly analysis\",\n      \"journal\": \"The Journal of biological chemistry\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 2 — mutagenesis with multiple readouts (folding, secretion, PM expression); primarily about GluR6 LBD but directly relevant to KA2/GluK5 heteromeric biogenesis\",\n      \"pmids\": [\"19342380\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2010,\n      \"finding\": \"The crystal structure of the GluK5 amino-terminal domain (ATD) was solved, revealing that it crystallizes as a dimer with a strikingly different dimer assembly at the R1 interface compared to low-affinity kainate receptor ATDs (GluK1-3). Both R1 and R2 domain dimer assemblies were characterized; the R2 assembly resembles other non-NMDA iGluRs, while the R1 interface is distinct. These structural differences at the R1 dimer interface are consistent with GluK5 being an obligate heteromer that cannot form functional homomeric channels.\",\n      \"method\": \"X-ray crystallography (high-resolution crystal structure)\",\n      \"journal\": \"Journal of molecular biology\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1 — first crystal structure of GluK5 ATD; high-resolution structural data with functional interpretation\",\n      \"pmids\": [\"20951142\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2009,\n      \"finding\": \"GluK2/GluK5 (GluR6/KA2) heteromeric kainate receptor channels exhibit bell-shaped steady-state concentration-response curves to both glutamate and AMPA, indicating two distinct agonist binding sites with markedly different affinities within the same receptor. The high-affinity site (GluK5) leads to channel opening, while the low-affinity site (GluK2) leads to strong desensitization upon agonist binding. This was confirmed by the GluK2(E738D) mutation, which selectively right-shifted the desensitization phase of the concentration-response curve.\",\n      \"method\": \"Two-electrode voltage clamp in Xenopus oocytes, site-directed mutagenesis, Markov model fitting\",\n      \"journal\": \"The Journal of physiology\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1 — quantitative biophysical characterization with mutagenesis and kinetic modeling; distinct functional roles for GluK2 and GluK5 subunits established\",\n      \"pmids\": [\"20026616\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2011,\n      \"finding\": \"The GluR6/KA2 ATD assembles as a heterodimer with extremely high affinity (Kd ~11 nM), ~32,000-fold tighter than KA2 ATD homodimer formation. Crystal structures of the GluR6/KA2 ATD heterodimer and heterotetramer assemblies revealed the molecular basis for obligate heteromeric assembly. Mutant cycle analysis confirmed that high-affinity ATD interactions are required for biosynthesis of functional heteromeric receptors.\",\n      \"method\": \"Sedimentation velocity analytical ultracentrifugation, X-ray crystallography, mutant cycle analysis, electrophysiology\",\n      \"journal\": \"Neuron\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1 — crystal structure plus biophysical affinity measurements plus functional mutagenesis; definitive mechanism of obligate heteromeric assembly\",\n      \"pmids\": [\"21791290\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2012,\n      \"finding\": \"GluK2 and GluK5 subunits assemble with 2:2 stoichiometry in heteromeric kainate receptors at the plasma membrane of live cells, as directly measured by single-molecule imaging with subunit counting. This definitively establishes the tetrameric architecture of GluK2/GluK5 receptors.\",\n      \"method\": \"Single-molecule fluorescence imaging with step-photobleaching for subunit counting in live cell plasma membranes\",\n      \"journal\": \"Cell reports\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1 — direct single-molecule counting in live cells; unambiguous stoichiometry measurement\",\n      \"pmids\": [\"22509486\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2013,\n      \"finding\": \"CaMKII directly phosphorylates three residues in the C-terminal domain of GluK5 (GRIK5 protein), markedly increasing the lateral mobility of kainate receptors (KARs) at hippocampal mossy fiber synapses, likely by decreasing GluK5 binding to PSD-95. CaMKII activation promotes surface expression of KARs at extrasynaptic sites while simultaneously decreasing synaptic KAR content, mediating long-term depression of KAR-mediated responses (KAR-LTD). Molecular replacement with phosphorylation-deficient GluK5 confirms that direct GluK5 phosphorylation by CaMKII is necessary for KAR-LTD.\",\n      \"method\": \"In vitro kinase assay, single-particle tracking (lateral mobility), molecular replacement in neurons, hippocampal slice electrophysiology (LTD), Ca2+ imaging\",\n      \"journal\": \"The EMBO journal\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1/2 — direct kinase assay identifies phosphorylation sites, single-particle tracking shows functional mobility consequence, molecular replacement confirms necessity; multiple orthogonal methods\",\n      \"pmids\": [\"23288040\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2013,\n      \"finding\": \"Ligand binding to only the GluK5 subunit (not the GluK2 subunit) is both necessary and sufficient for surface expression of heteromeric GluK2/GluK5 receptors. Mutations that reduce agonist affinity in GluK5 decrease functional heteromeric receptor surface expression and cannot be rescued by wild-type GluK2 or competitive antagonists, while analogous GluK2 mutations can be rescued by co-assembly with wild-type GluK5. This reveals a distinct quality-control role for GluK5 agonist binding in heteromeric KAR trafficking.\",\n      \"method\": \"Site-directed mutagenesis of ligand-binding domain, electrophysiology, surface expression assays in transfected cells\",\n      \"journal\": \"Cellular and molecular neurobiology\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 2 — mutagenesis with rescue experiments identifying subunit-specific trafficking role; single lab\",\n      \"pmids\": [\"23975096\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2014,\n      \"finding\": \"Domoate produces a long-lasting inhibition specifically of the GluK5 subunit: brief exposure to domoate prevents GluK5 activation by other agonists for several minutes. In heteromeric GluK2/K5 receptors, the domoate-bound GluK5 state is not a desensitized or blocked conformation, as the receptor can still be fully activated through the GluK2 subunit. A mutation in GluK5 that reduces agonist binding affinity prevents this long-lasting inhibition, establishing its site-specificity.\",\n      \"method\": \"Whole-cell electrophysiology in transfected cells expressing homomeric and heteromeric kainate receptors, site-directed mutagenesis\",\n      \"journal\": \"Neuropharmacology\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 2 — electrophysiology with mutagenesis defining subunit-specific domoate action; single lab\",\n      \"pmids\": [\"24859608\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2017,\n      \"finding\": \"GluK5 (encoded by GRIK5) is localized presynaptically to the ribbon synapses of rod photoreceptors in the mouse retina, as shown by double-immunofluorescence and electron microscopy. In GluK5-deficient mice, the structural integrity of synaptic ribbons is severely altered, revealing a novel non-ionotropic function of GluK5 in organizing synaptic ribbons in rod photoreceptor presynaptic terminals.\",\n      \"method\": \"Immunofluorescence, electron microscopy, GluK5 knockout mouse analysis\",\n      \"journal\": \"PloS one\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 2 — direct localization by EM plus KO mouse structural phenotype; single lab\",\n      \"pmids\": [\"28235022\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2018,\n      \"finding\": \"Two ER retention signals in the GluK5 C-terminus (an arginine-based signal and a di-leucine motif) are masked not primarily by GluK2 co-assembly but by the scaffold proteins SAP97 and CASK. SAP97 in an extended conformation (facilitated by CASK) engages both its SH3 and GK domains to sterically block the ER retention signals in GluK5. SAP97 and CASK are also required for sorting GluK5-containing receptor complexes into the local dendritic secretory pathway in neurons, revealing that ER retention signals in GluK5 function as dendritic sorting signals rather than simply preventing homomeric export.\",\n      \"method\": \"Co-immunoprecipitation, in vitro binding, surface expression assays, live-cell imaging of dendritic secretory pathway in neurons, site-directed mutagenesis\",\n      \"journal\": \"Biochimica et biophysica acta. Molecular cell research\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 2 — Co-IP plus functional trafficking assays in neurons; single lab but multiple methods\",\n      \"pmids\": [\"30339823\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2019,\n      \"finding\": \"Single-molecule FRET reveals that in full-length heteromeric GluK2/GluK5 receptors, GluK2 and GluK5 subunits adopt a specific arrangement within the dimer-of-dimers tetramer, with GluK5 occupying defined positions at the amino-terminal domain interface. The conformational dynamics of both the amino-terminal domain and agonist-binding domain interfaces differ between resting and desensitized states, and these dynamics differ between homomeric and heteromeric receptors, providing insight into how GluK5 incorporation alters gating.\",\n      \"method\": \"Single-molecule FRET (smFRET) on purified full-length receptors\",\n      \"journal\": \"Biochimica et biophysica acta. Biomembranes\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 1 — smFRET on full-length receptor; novel structural/dynamic data but no mutagenesis validation\",\n      \"pmids\": [\"31194959\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2019,\n      \"finding\": \"Depletion of the GRIK5 ortholog in zebrafish reduces blood vessel numbers and integrity in the eye and increases vascular permeability, demonstrating a role for GluK5 in vascular biology and eye development beyond classical neurotransmission. Reduced genetically predicted expression of GRIK5 in humans is associated with comorbid vascular and eye diseases in electronic health records.\",\n      \"method\": \"Zebrafish morpholino knockdown, vascular integrity and permeability assays, electronic health record phenome-wide analysis\",\n      \"journal\": \"American journal of human genetics\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 2/3 — zebrafish KD with defined vascular phenotype; novel non-CNS function; single model system\",\n      \"pmids\": [\"30827500\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2021,\n      \"finding\": \"GluK5 (GluK5 KO mice on C57BL/6N background) share behavioral phenotypes with GluK2 KO mice including reduced locomotor activity, impaired motor function, and enhanced depressive-like behavior. GluK5 KO mice specifically show enhanced contextual memory, identifying a subunit-specific role for GluK5 in regulating contextual memory encoding and depressive-like behavior.\",\n      \"method\": \"Behavioral battery in genetic knockout mice (open field, rotarod, forced swim, contextual fear conditioning, etc.)\",\n      \"journal\": \"Behavioural brain research\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 2 — clean KO with defined behavioral phenotypes; first GluK5 KO behavioral characterization on pure genetic background\",\n      \"pmids\": [\"33631192\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2021,\n      \"finding\": \"GluK1/K5, GluK2/K5, and GluK3/K5 heteromeric kainate receptors can form with either 3:1 or 2:2 stoichiometry as assessed by single-molecule fluorescence, and tri- and tetra-heteromeric KARs containing three or four different subunit types (including GluK5) can be detected. This establishes that GluK5-containing receptors have greater compositional diversity than previously appreciated.\",\n      \"method\": \"Single-molecule fluorescence imaging (multi-color), single-particle counting in live cells\",\n      \"journal\": \"Cell reports\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 1/2 — single-molecule imaging; direct measurement of stoichiometric flexibility\",\n      \"pmids\": [\"34706237\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2023,\n      \"finding\": \"In heteromeric GluK2/GluK5 receptors, partial agonism by AMPA is mediated primarily through conformational differences at the GluK2 agonist-binding domain cleft: AMPA binding produces intermediate cleft closure at GluK2 (between apo/open and glutamate/closed states), while the GluK5 agonist-binding domain cleft shows no significant difference between AMPA- and glutamate-bound states. Additionally, the agonist-binding domain dimer interface is not decoupled by AMPA (unlike with full agonist glutamate), establishing distinct subunit contributions to partial agonism.\",\n      \"method\": \"Single-molecule FRET (smFRET) on full-length GluK2/GluK5 receptors with subunit-specific labeling\",\n      \"journal\": \"Proteins\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 1 — smFRET distinguishing subunit-specific conformational states; mechanistic insight into partial agonism\",\n      \"pmids\": [\"37526035\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2017,\n      \"finding\": \"Preferential heterodimer formation of GluK5 ATD with GluK1-3 ATDs is energetically favored over GluK5 homodimerization, with heterodimer affinities spanning many orders of magnitude above homodimer stabilities. This thermodynamic framework explains the observed physiological receptor subunit combinations and suggests an assembly pathway in which high-affinity ATD heterodimerization drives GluK5 incorporation into functional heteromers.\",\n      \"method\": \"Fluorescence-detected sedimentation velocity analytical ultracentrifugation (systematic thermodynamic measurement of homo- and heterodimer affinities)\",\n      \"journal\": \"eLife\",\n      \"confidence\": \"High\",\n      \"confidence_rationale\": \"Tier 1 — rigorous biophysical thermodynamic measurement across multiple subunit combinations; strong mechanistic basis for assembly\",\n      \"pmids\": [\"29058671\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2008,\n      \"finding\": \"GLIK5 (GLU(K5))-containing kainate receptors tonically reduce the speed of neuroblast migration along the lateral ventricle in the postnatal subventricular zone. Application of GLU(K5) receptor antagonists (NS3763 for homomeric; UB302 for heteromeric GLU(K5)) increased neuroblast migration speed by ~38% in whole-mount preparations, while GLU(K5) activation increased intracellular Ca2+ in ~60% of neuroblasts. This establishes a tonic, non-synaptic role for GluK5-containing receptors in regulating neural progenitor migration.\",\n      \"method\": \"Whole-mount lateral ventricle preparation with time-lapse imaging, patch-clamp electrophysiology, Ca2+ imaging, selective pharmacological antagonists, RT-PCR from single aspirated cells\",\n      \"journal\": \"The Journal of physiology\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 2 — pharmacological and calcium imaging in native tissue preparation with defined migration phenotype; single lab\",\n      \"pmids\": [\"18565997\"],\n      \"is_preprint\": false\n    },\n    {\n      \"year\": 2007,\n      \"finding\": \"KA2 antisense oligodeoxynucleotide knockdown in vivo reduces expression of both KA2 and GluR6 subunits, suppresses assembly of the GluR6/KA2-PSD95-MLK3 signaling module, inhibits JNK activation and c-jun phosphorylation after cerebral ischemia/reperfusion, and increases neuronal survival in CA1 after 5 days reperfusion. Combined KA2 and GluR6 knockdown has additive neuroprotective effects, establishing functional cooperation between these subunits in activating the PSD95-MLK3-MKK4/7-JNK3 death pathway.\",\n      \"method\": \"Intracerebroventricular antisense oligodeoxynucleotide infusion, co-immunoprecipitation, immunoblot, neuronal survival counting in rat ischemia model\",\n      \"journal\": \"Journal of neuroscience research\",\n      \"confidence\": \"Medium\",\n      \"confidence_rationale\": \"Tier 3 — antisense knockdown with signaling pathway readout in vivo; mechanistic pathway placement but indirect method\",\n      \"pmids\": [\"17639597\"],\n      \"is_preprint\": false\n    }\n  ],\n  \"current_model\": \"GluK5 (GRIK5/KA2) is a high-affinity kainate receptor subunit that cannot form functional homomeric channels because it is retained in the ER via arginine-rich and di-leucine motifs in its C-terminus and an intracellular loop, which are recognized by COPI coat proteins; obligate co-assembly with GluK1-3 subunits (especially GluK6/GluR6 in brain) is required for ER egress — facilitated by 32,000-fold preferred ATD heterodimerization — and GluK5 agonist-site occupancy serves as a quality-control checkpoint for forward trafficking; once at the synapse, GluK5 confers high glutamate affinity, slow deactivation kinetics, AMPA responsiveness, and 2:2 stoichiometry to heteromeric receptors, is clustered and regulated by SAP90/PSD-95 family members (via its C-terminal SH3/GK-binding domain), and undergoes CaMKII-dependent phosphorylation of its C-terminus to drive lateral diffusion away from synapses and KAR long-term depression; additionally, GluK5 has non-canonical roles including presynaptic organization of photoreceptor ribbon synapses and regulation of neuroblast migration and vascular integrity.\"\n}\n```","stage2_raw":"```json\n{\n  \"mechanistic_narrative\": \"GRIK5 (GluK5/KA2) is a high-affinity kainate receptor subunit that obligately co-assembles with low-affinity subunits GluK1–3 to form functional heteromeric ionotropic glutamate receptors at excitatory synapses. GRIK5 cannot form functional homomeric channels due to ER retention signals—an arginine-rich motif and a di-leucine sequence in its C-terminus plus an intracellular loop signal—that are recognized by COPI coat proteins and masked upon heteromeric assembly with GluK2 or by scaffolding proteins SAP97/CASK; ligand occupancy of the GluK5 binding domain is the rate-limiting step for heteromer surface trafficking [PMID:12878702, PMID:16595684, PMID:16807331, PMID:23975096, PMID:30339823]. GluK2/GluK5 heteromers assemble with 2:2 stoichiometry and exhibit increased unitary conductance, AMPA sensitivity, and distinct gating dynamics compared to homomeric channels [PMID:22509486, PMID:8836240, PMID:1373632]. CaMKII phosphorylation of the GluK5 C-terminal domain increases lateral diffusion by disrupting PSD-95 binding, driving kainate receptor long-term depression at hippocampal mossy fiber–CA3 synapses, while genetic ablation of GluK5 abolishes heterosynaptic facilitation, alters postsynaptic EPSC kinetics, and produces behavioral deficits including reduced locomotion and enhanced depression-like behavior [PMID:23288040, PMID:12533602, PMID:33631192].\",\n  \"teleology\": [\n    {\n      \"year\": 1992,\n      \"claim\": \"Establishing that KA2 is an obligate heteromeric partner resolved a puzzle: despite high-affinity kainate binding, KA2 alone was electrically silent, and functional channels required co-assembly with GluR5 or GluR6, conferring novel pharmacological properties including AMPA sensitivity.\",\n      \"evidence\": \"Heterologous expression in oocytes/HEK cells with electrophysiology\",\n      \"pmids\": [\"1373632\"],\n      \"confidence\": \"High\",\n      \"gaps\": [\"Stoichiometry of the heteromeric complex unknown\", \"Mechanism preventing homomeric function unresolved\", \"Native co-expression patterns not yet mapped\"]\n    },\n    {\n      \"year\": 1994,\n      \"claim\": \"Demonstrating physical co-assembly of KA2 and GluR6 in both recombinant and native brain tissue established that heteromeric kainate receptors exist in vivo, and ultrastructural localization placed KA2 at postsynaptic densities in hippocampus and cortex.\",\n      \"evidence\": \"Reciprocal co-IP from HEK cells and rat brain; immunoelectron microscopy\",\n      \"pmids\": [\"8288598\", \"7852627\"],\n      \"confidence\": \"High\",\n      \"gaps\": [\"Presynaptic role not yet addressed\", \"Which subunit combinations predominate at specific synapses unknown\"]\n    },\n    {\n      \"year\": 1996,\n      \"claim\": \"Quantifying biophysical contributions of KA2 incorporation—a 2–3 fold increase in unitary conductance and shifted agonist sensitivity—defined the functional impact of heteromerization at the single-channel level.\",\n      \"evidence\": \"Noise analysis and patch-clamp recordings from transfected HEK293 cells\",\n      \"pmids\": [\"8836240\"],\n      \"confidence\": \"High\",\n      \"gaps\": [\"Structural basis of conductance change unknown\", \"Desensitization mechanism unresolved\"]\n    },\n    {\n      \"year\": 1997,\n      \"claim\": \"Matching native kainate currents in trigeminal ganglion neurons to recombinant GluR5/KA2 properties validated the physiological relevance of this heteromeric combination in peripheral sensory neurons.\",\n      \"evidence\": \"RT-PCR, pharmacology, and patch-clamp on acutely dissociated trigeminal neurons\",\n      \"pmids\": [\"9254673\"],\n      \"confidence\": \"High\",\n      \"gaps\": [\"Contribution to pain signaling not directly tested\", \"Other native KA2-containing combinations not surveyed\"]\n    },\n    {\n      \"year\": 2003,\n      \"claim\": \"Identification of ER retention signals (arginine-rich motif, di-leucine sequence) in the KA2 C-terminus explained homomeric ER retention and established that heteromeric assembly sterically masks these signals, providing a quality-control mechanism ensuring only properly assembled receptors reach the surface; KA2 knockout mice demonstrated that this subunit is essential for both presynaptic facilitation and normal postsynaptic EPSC kinetics at mossy fiber–CA3 synapses.\",\n      \"evidence\": \"Mutagenesis with surface biotinylation in HEK cells and neurons; hippocampal slice electrophysiology in KA2−/− mice\",\n      \"pmids\": [\"12878702\", \"12533602\", \"14511640\"],\n      \"confidence\": \"High\",\n      \"gaps\": [\"Molecular chaperones involved in assembly unknown\", \"Identity of the masking interface on GluR6 unresolved\", \"Intracellular loop retention signal not yet identified\"]\n    },\n    {\n      \"year\": 2006,\n      \"claim\": \"Discovery that COPI coat proteins bind the arginine-rich retention motif and that 14-3-3 proteins compete for binding upon heteromerization defined the ER-to-surface trafficking switch; an additional retention signal in the intracellular loop was identified, and GluR6 knockout but not GluR5 knockout abolished native KA2 surface expression, establishing GluR6 as the essential trafficking partner in vivo.\",\n      \"evidence\": \"Co-IP from cerebellum, peptide pulldown, mutagenesis, analysis of GluR5 and GluR6 KO mouse tissue\",\n      \"pmids\": [\"16595684\", \"16807331\"],\n      \"confidence\": \"High\",\n      \"gaps\": [\"14-3-3 isoform specificity unclear\", \"Role of intracellular loop signal in COPI binding not tested\"]\n    },\n    {\n      \"year\": 2007,\n      \"claim\": \"KA2 knockdown in vivo disrupted a GluR6/KA2–PSD-95–MLK3 signaling complex and reduced JNK/c-jun activation after ischemia, linking the KA2-containing receptor to excitotoxic cell-death signaling beyond ionotropic function.\",\n      \"evidence\": \"Intracerebroventricular antisense oligodeoxynucleotide infusion in rat ischemia model with IP and histology\",\n      \"pmids\": [\"17639597\"],\n      \"confidence\": \"Medium\",\n      \"gaps\": [\"Antisense specificity for KA2 versus off-target effects not fully controlled\", \"Whether the neuroprotective effect is channel-dependent or metabotropic unknown\"]\n    },\n    {\n      \"year\": 2010,\n      \"claim\": \"Crystal structures of the GluK5 amino-terminal domain revealed a dimer R1 interface markedly different from GluK1–3, providing a structural rationale for why GluK5 cannot form functional homomers and must obligately hetero-dimerize.\",\n      \"evidence\": \"X-ray crystallography of GluK5 ATD\",\n      \"pmids\": [\"20951142\"],\n      \"confidence\": \"High\",\n      \"gaps\": [\"Full-length heteromeric receptor structure not available\", \"How ATD interface controls channel gating unknown\"]\n    },\n    {\n      \"year\": 2012,\n      \"claim\": \"Single-molecule subunit counting established that GluK2/GluK5 heteromeric receptors assemble with strict 2:2 stoichiometry, resolving the subunit composition question.\",\n      \"evidence\": \"Single-molecule fluorescence with step-photobleaching in live-cell membranes\",\n      \"pmids\": [\"22509486\"],\n      \"confidence\": \"High\",\n      \"gaps\": [\"Arrangement of alternating vs. adjacent subunit pairs not determined\", \"Whether 2:2 stoichiometry applies to all GluK5-containing combinations untested\"]\n    },\n    {\n      \"year\": 2013,\n      \"claim\": \"CaMKII-dependent phosphorylation of three C-terminal sites on GluK5 was shown to increase lateral diffusion, reduce PSD-95 interaction, and drive kainate receptor long-term depression (KAR-LTD) at mossy fiber synapses, identifying GluK5 phosphorylation as the molecular switch for activity-dependent synaptic plasticity of kainate receptors; separately, GluK5 ligand-binding domain occupancy was shown to be rate-limiting for heteromeric surface trafficking.\",\n      \"evidence\": \"In vitro kinase assay, single-particle tracking, molecular replacement in neurons, slice electrophysiology; mutagenesis of S2 domain with functional rescue\",\n      \"pmids\": [\"23288040\", \"23975096\"],\n      \"confidence\": \"High\",\n      \"gaps\": [\"Phosphatase reversing CaMKII phosphorylation unidentified\", \"Behavioral consequences of blocking KAR-LTD not tested\", \"Whether GluK5 LBD occupancy checkpoint operates in all neuron types unknown\"]\n    },\n    {\n      \"year\": 2018,\n      \"claim\": \"SAP97 (in extended conformation) and CASK were identified as scaffolds that mask GluK5 ER retention signals and sort KAR complexes into the dendritic secretory pathway, revealing a post-assembly trafficking step beyond heteromerization alone.\",\n      \"evidence\": \"Co-IP, FRET conformational analysis, mutagenesis, neuronal trafficking assays\",\n      \"pmids\": [\"30339823\"],\n      \"confidence\": \"Medium\",\n      \"gaps\": [\"Whether SAP97/CASK masking operates at all synapse types unknown\", \"Structural basis of SAP97 SH3/GuK interaction with retention signals not resolved\"]\n    },\n    {\n      \"year\": 2019,\n      \"claim\": \"smFRET on full-length GluK2/GluK5 receptors defined subunit arrangement and conformational dynamics at the ABD and ATD interfaces during resting and desensitized states, revealing that partial agonism by AMPA is mediated primarily through GluK2 conformational changes while GluK5 remains in a similar conformation for partial and full agonists.\",\n      \"evidence\": \"Single-molecule FRET on full-length heteromeric receptors\",\n      \"pmids\": [\"31194959\", \"37526035\"],\n      \"confidence\": \"Medium\",\n      \"gaps\": [\"Cryo-EM structure of full heteromeric receptor in multiple states not available\", \"How GluK5 conformational state influences ion permeation pathway not defined\"]\n    },\n    {\n      \"year\": 2021,\n      \"claim\": \"GluK5 knockout mice showed reduced locomotor activity, impaired motor function, depressive-like behavior, and enhanced contextual memory, distinguishing subunit-specific behavioral roles from those of GluK2.\",\n      \"evidence\": \"Behavioral battery in GluK5−/− mice on C57BL/6N background\",\n      \"pmids\": [\"33631192\"],\n      \"confidence\": \"Medium\",\n      \"gaps\": [\"Circuit-level mechanisms underlying behavioral phenotypes undefined\", \"Conditional/cell-type-specific KO not performed\", \"Human disease relevance not established by direct genetics\"]\n    },\n    {\n      \"year\": null,\n      \"claim\": \"A high-resolution structure of the full-length GluK2/GluK5 heteromeric receptor in multiple functional states, the identity of the phosphatase opposing CaMKII phosphorylation of GluK5, and circuit-specific roles of GluK5-containing receptors in behavior and disease remain to be determined.\",\n      \"evidence\": \"\",\n      \"pmids\": [],\n      \"confidence\": \"Low\",\n      \"gaps\": [\"Full-length heteromeric receptor cryo-EM structure in multiple states needed\", \"Phosphatase opposing CaMKII at GluK5 C-terminus unknown\", \"No human Mendelian disease linked by direct causative mutation\"]\n    }\n  ],\n  \"mechanism_profile\": {\n    \"molecular_activity\": [\n      {\"term_id\": \"GO:0005215\", \"supporting_discovery_ids\": [0, 4, 10]},\n      {\"term_id\": \"GO:0060089\", \"supporting_discovery_ids\": [0, 5]}\n    ],\n    \"localization\": [\n      {\"term_id\": \"GO:0005783\", \"supporting_discovery_ids\": [8, 12, 13]},\n      {\"term_id\": \"GO:0005886\", \"supporting_discovery_ids\": [8, 9, 15]},\n      {\"term_id\": \"GO:0005634\", \"supporting_discovery_ids\": [6, 7]}\n    ],\n    \"pathway\": [\n      {\"term_id\": \"R-HSA-112316\", \"supporting_discovery_ids\": [0, 4, 10, 16]},\n      {\"term_id\": \"R-HSA-162582\", \"supporting_discovery_ids\": [16, 25]},\n      {\"term_id\": \"R-HSA-9609507\", \"supporting_discovery_ids\": [8, 12, 13, 20]}\n    ],\n    \"complexes\": [\n      \"GluK2/GluK5 heteromeric kainate receptor\",\n      \"GluK1/GluK5 heteromeric kainate receptor\",\n      \"GluR6/KA2-PSD95-MLK3 signaling complex\"\n    ],\n    \"partners\": [\n      \"GRIK2\",\n      \"GRIK1\",\n      \"DLG4\",\n      \"DLG1\",\n      \"CASK\",\n      \"YWHAZ\",\n      \"CAMK2A\",\n      \"COPB1\"\n    ],\n    \"other_free_text\": []\n  }\n}\n```\n\n--- ROUND 2 (R2/R3, augmented corpus) ---\n\n```json\n{\n  \"mechanistic_narrative\": \"GRIK5 encodes GluK5 (KA2), a high-affinity kainate receptor subunit that binds kainate with ~15 nM affinity but cannot form functional homomeric channels; it obligately co-assembles with GluK1–3 subunits—preferentially GluK2 in brain—to produce heteromeric receptors with distinct biophysical properties including AMPA responsiveness, slow deactivation kinetics matching native KAR-EPSCs, and bell-shaped concentration-response curves arising from subunit-specific high- and low-affinity agonist sites [PMID:1373632, PMID:18562611, PMID:20026616]. ER retention of GluK5 homomers is enforced by arginine-rich and di-leucine motifs in its C-terminus and an intracellular loop, recognized by COPI coat proteins; heteromeric assembly masks these signals (aided by SAP97/CASK engagement), and ligand occupancy of the GluK5 binding site serves as a quality-control checkpoint for forward trafficking [PMID:12878702, PMID:16595684, PMID:15583001, PMID:30339823]. At synapses, GluK5 is scaffolded by PSD-95 family members via its SH3/GK-binding C-terminal domain, and CaMKII-dependent phosphorylation of three GluK5 C-terminal residues increases lateral receptor mobility and drives kainate receptor long-term depression at mossy fiber–CA3 synapses [PMID:9808460, PMID:23288040]. Beyond ionotropic neurotransmission, GluK5 organizes photoreceptor ribbon synapse architecture, tonically regulates neuroblast migration speed, and contributes to vascular integrity in the eye [PMID:28235022, PMID:18565997, PMID:30827500].\",\n  \"teleology\": [\n    {\n      \"year\": 1992,\n      \"claim\": \"The fundamental question of whether KA2 functions as an ion channel was resolved: GluK5 binds kainate with high affinity but requires co-assembly with GluK1–3 subunits to produce functional channels, establishing its obligate heteromeric nature and showing it confers AMPA sensitivity and altered desensitization to heteromers.\",\n      \"evidence\": \"Heterologous expression in oocytes/HEK cells with electrophysiology and radioligand binding across multiple subunit combinations\",\n      \"pmids\": [\"1373632\"],\n      \"confidence\": \"High\",\n      \"gaps\": [\"Stoichiometry of heteromeric assemblies unknown\", \"Mechanism of ER retention not yet addressed\", \"Native receptor composition in specific brain regions undetermined\"]\n    },\n    {\n      \"year\": 1994,\n      \"claim\": \"Whether GluK5/GluK2 heteromers exist in native brain was established by reciprocal co-immunoprecipitation from rat brain membranes, confirming the GluR6/KA2 complex as a physiologically relevant entity.\",\n      \"evidence\": \"Reciprocal co-immunoprecipitation from HEK cells and native rat brain membranes with deglycosylation analysis\",\n      \"pmids\": [\"8288598\"],\n      \"confidence\": \"High\",\n      \"gaps\": [\"Subunit stoichiometry within native complexes unknown\", \"Regional and cell-type specificity of heteromer expression not resolved\"]\n    },\n    {\n      \"year\": 1996,\n      \"claim\": \"How GluK5 alters the biophysical fingerprint of heteromeric channels was quantified: GluK5 incorporation increases unitary conductance of edited GluK2(R)/GluK5 channels ~2–3-fold, modifies burst kinetics, and confers AMPA sensitivity, explaining functional diversity of native KARs.\",\n      \"evidence\": \"Single-channel and noise analysis patch-clamp electrophysiology on defined recombinant channels in HEK293 cells\",\n      \"pmids\": [\"8836240\", \"8730589\"],\n      \"confidence\": \"High\",\n      \"gaps\": [\"Whether these biophysical properties match native synaptic KAR-EPSCs not yet tested\", \"Structural basis for conductance increase unknown\"]\n    },\n    {\n      \"year\": 1997,\n      \"claim\": \"Native KARs in trigeminal ganglion neurons were shown to match recombinant GluR5(R)/KA2 heteromers pharmacologically and kinetically, providing the first strong evidence that GluK5-containing heteromers are the predominant native KAR in a defined neuronal population.\",\n      \"evidence\": \"RT-PCR plus patch-clamp electrophysiology and pharmacological profiling in acutely dissociated trigeminal neurons\",\n      \"pmids\": [\"9254673\"],\n      \"confidence\": \"High\",\n      \"gaps\": [\"Heteromeric identity inferred pharmacologically rather than by direct biochemical isolation from these neurons\"]\n    },\n    {\n      \"year\": 1998,\n      \"claim\": \"The scaffolding mechanism linking GluK5 to the postsynaptic density was identified: PSD-95/SAP90 binds GluK5's C-terminus via SH3 and GK domains (not PDZ domains), and this interaction modulates channel desensitization, establishing how GluK5 is anchored and regulated at synapses.\",\n      \"evidence\": \"Co-immunoprecipitation from neurons, yeast two-hybrid, and electrophysiology in transfected cells\",\n      \"pmids\": [\"9808460\"],\n      \"confidence\": \"High\",\n      \"gaps\": [\"Phosphorylation-dependent regulation of this interaction not yet explored\", \"Whether SAP90 binding is required for synaptic localization in vivo untested\"]\n    },\n    {\n      \"year\": 2003,\n      \"claim\": \"The mechanism preventing GluK5 homomeric surface expression was dissected: arginine-rich and di-leucine C-terminal motifs plus an intracellular loop signal mediate ER retention; heteromeric assembly masks these signals. In parallel, GluK5 knockout mice revealed that GluK5 sets presynaptic agonist affinity and postsynaptic decay kinetics at mossy fiber–CA3 synapses.\",\n      \"evidence\": \"Surface biotinylation, mutagenesis, immunofluorescence, electrophysiology in transfected cells and neurons; hippocampal slice electrophysiology in KA2−/− mice\",\n      \"pmids\": [\"12878702\", \"12533602\", \"12950450\"],\n      \"confidence\": \"High\",\n      \"gaps\": [\"Identity of the coat protein machinery mediating ER retention not yet known\", \"Role of GluK5 agonist binding in trafficking not addressed\"]\n    },\n    {\n      \"year\": 2004,\n      \"claim\": \"A quality-control checkpoint was identified: intact glutamate binding to the GluK5 ligand-binding domain (T675) is required for surface delivery of heteromeric GluK2/GluK5 receptors, even though assembly with GluK2 still occurs, revealing that agonist occupancy at GluK5 gates forward trafficking independently of assembly.\",\n      \"evidence\": \"Site-directed mutagenesis of binding residue T675, surface biotinylation, radioligand binding, and pulse-chase degradation in transfected cells and neurons\",\n      \"pmids\": [\"15583001\"],\n      \"confidence\": \"High\",\n      \"gaps\": [\"Whether endogenous ER glutamate concentration is sufficient for this checkpoint in vivo unknown\", \"ER chaperone partners mediating the checkpoint unidentified\"]\n    },\n    {\n      \"year\": 2006,\n      \"claim\": \"The molecular machinery enforcing GluK5 ER retention was identified as COPI vesicle coat proteins, which directly bind the arginine-rich signal; heteromeric assembly displaces COPI and recruits 14-3-3 proteins for forward trafficking. Additionally, GluK6 (not GluK5) knockout specifically abolishes native GluK5 surface expression, confirming GluK2/GluK6 as the obligate partner for ER egress in vivo.\",\n      \"evidence\": \"Peptide pulldown, co-immunoprecipitation from cerebellum, surface expression assays, analysis of GluR5 and GluR6 KO mice\",\n      \"pmids\": [\"16595684\", \"16807331\"],\n      \"confidence\": \"High\",\n      \"gaps\": [\"Whether 14-3-3 binding is phosphorylation-dependent not resolved\", \"Which COPI subunit(s) directly contact the arginine motif not determined at atomic resolution\"]\n    },\n    {\n      \"year\": 2008,\n      \"claim\": \"How GluK5 shapes synaptic current kinetics was resolved: GluK2/GluK5 heteromers produce slowly deactivating currents matching native KAR-EPSCs, with kinetic modeling attributing this to stabilization of partially liganded open states by GluK5, directly explaining the characteristically slow KAR-EPSC decay. Separately, GluK5-containing receptors were shown to tonically restrain neuroblast migration speed in the SVZ.\",\n      \"evidence\": \"Fast glutamate application to outside-out patches with Markov modeling; time-lapse migration imaging and calcium imaging in whole-mount SVZ with selective pharmacology\",\n      \"pmids\": [\"18562611\", \"18565997\"],\n      \"confidence\": \"High\",\n      \"gaps\": [\"In vivo confirmation that GluK5 determines KAR-EPSC kinetics at defined synapses beyond mossy fiber–CA3 not shown\", \"Signaling pathway linking GluK5 activation to migration speed regulation unknown\"]\n    },\n    {\n      \"year\": 2010,\n      \"claim\": \"Structural determinants of obligate heteromeric assembly were revealed: the GluK5 ATD crystal structure showed a unique R1 dimer interface incompatible with stable homodimerization, and subsequent GluK2/GluK5 ATD heterodimer structures demonstrated ~32,000-fold preferential heterodimerization (Kd ~11 nM), providing the thermodynamic basis for obligate heteromeric assembly.\",\n      \"evidence\": \"X-ray crystallography of GluK5 ATD homo- and heterodimers; analytical ultracentrifugation measuring homo- vs. heterodimer affinities\",\n      \"pmids\": [\"20951142\", \"21791290\"],\n      \"confidence\": \"High\",\n      \"gaps\": [\"Full-length heteromeric receptor structure not yet available\", \"How ATD heterodimerization communicates to transmembrane domain assembly unclear\"]\n    },\n    {\n      \"year\": 2012,\n      \"claim\": \"The stoichiometry question was definitively answered: GluK2/GluK5 receptors assemble with 2:2 stoichiometry at the plasma membrane, as measured by single-molecule subunit counting, though later work showed 3:1 stoichiometry and tri/tetra-heteromeric assemblies are also possible.\",\n      \"evidence\": \"Single-molecule fluorescence photobleaching step-counting in live cells; multi-color single-molecule imaging\",\n      \"pmids\": [\"22509486\", \"34706237\"],\n      \"confidence\": \"High\",\n      \"gaps\": [\"Functional consequences of 3:1 vs. 2:2 stoichiometry on channel properties not systematically characterized\", \"Whether stoichiometric flexibility is regulated in vivo unknown\"]\n    },\n    {\n      \"year\": 2013,\n      \"claim\": \"A synaptic plasticity mechanism was established: CaMKII directly phosphorylates three GluK5 C-terminal residues, increasing lateral mobility of KARs away from synapses (likely by disrupting PSD-95 binding) and driving KAR long-term depression at mossy fiber synapses—confirmed by molecular replacement with phosphodeficient GluK5.\",\n      \"evidence\": \"In vitro kinase assay, single-particle tracking of lateral mobility, molecular replacement in neurons, hippocampal slice LTD recordings\",\n      \"pmids\": [\"23288040\"],\n      \"confidence\": \"High\",\n      \"gaps\": [\"Identity of the phosphatase(s) reversing CaMKII phosphorylation unknown\", \"Whether this mechanism operates at synapses other than mossy fiber–CA3 not tested\"]\n    },\n    {\n      \"year\": 2017,\n      \"claim\": \"A non-ionotropic structural role for GluK5 was discovered: GluK5 localizes presynaptically to rod photoreceptor ribbon synapses, and GluK5 knockout disrupts ribbon synapse architecture, revealing a function independent of postsynaptic glutamate signaling.\",\n      \"evidence\": \"Double-immunofluorescence and electron microscopy in wild-type and GluK5 KO mouse retina\",\n      \"pmids\": [\"28235022\"],\n      \"confidence\": \"Medium\",\n      \"gaps\": [\"Molecular partners mediating GluK5's structural role at ribbons unidentified\", \"Whether this is ion-channel-independent confirmed functionally\", \"Single lab observation\"]\n    },\n    {\n      \"year\": 2018,\n      \"claim\": \"The ER retention masking mechanism was refined: SAP97 (in an extended conformation facilitated by CASK) rather than GluK2 co-assembly per se masks the GluK5 C-terminal retention signals, and these signals double as dendritic sorting determinants, reframing ER retention as a targeting mechanism for local dendritic secretory trafficking.\",\n      \"evidence\": \"Co-immunoprecipitation, in vitro binding, surface expression assays, live-cell imaging of dendritic secretory pathway in neurons\",\n      \"pmids\": [\"30339823\"],\n      \"confidence\": \"Medium\",\n      \"gaps\": [\"Relative contributions of SAP97/CASK masking vs. heteromeric assembly masking in vivo not quantified\", \"Whether dendritic sorting is synapse-type specific unknown\"]\n    },\n    {\n      \"year\": 2023,\n      \"claim\": \"Subunit-specific conformational dynamics underlying partial agonism were resolved: in GluK2/GluK5 receptors, AMPA produces intermediate cleft closure at GluK2 but not GluK5, and fails to decouple the agonist-binding domain dimer interface, establishing distinct conformational contributions of each subunit to partial vs. full agonism.\",\n      \"evidence\": \"Single-molecule FRET with subunit-specific labeling on purified full-length GluK2/GluK5 receptors\",\n      \"pmids\": [\"37526035\"],\n      \"confidence\": \"Medium\",\n      \"gaps\": [\"Cryo-EM structures of partial vs. full agonist-bound states not available\", \"Whether these conformational differences extend to other partial agonists untested\"]\n    },\n    {\n      \"year\": null,\n      \"claim\": \"Key open questions include: the high-resolution full-length structure of a GluK2/GluK5 heteromeric receptor in defined functional states; the molecular mechanism by which GluK5 organizes photoreceptor ribbon synapses; whether variable stoichiometries (2:2 vs. 3:1) are regulated and functionally distinct in vivo; and how GluK5 contributes to vascular integrity and non-neuronal phenotypes.\",\n      \"evidence\": \"\",\n      \"pmids\": [],\n      \"confidence\": \"Low\",\n      \"gaps\": [\"No full-length heteromeric cryo-EM structure published\", \"Non-ionotropic signaling mechanisms of GluK5 uncharacterized\", \"Vascular phenotype observed only in zebrafish with morpholino knockdown\"]\n    }\n  ],\n  \"mechanism_profile\": {\n    \"molecular_activity\": [\n      {\"term_id\": \"GO:0005215\", \"supporting_discovery_ids\": [0, 4, 5, 18, 21]},\n      {\"term_id\": \"GO:0060089\", \"supporting_discovery_ids\": [0, 21, 26]}\n    ],\n    \"localization\": [\n      {\"term_id\": \"GO:0005783\", \"supporting_discovery_ids\": [11, 13, 14, 16, 17]},\n      {\"term_id\": \"GO:0005886\", \"supporting_discovery_ids\": [3, 11, 23, 32]}\n    ],\n    \"pathway\": [\n      {\"term_id\": \"R-HSA-112316\", \"supporting_discovery_ids\": [0, 4, 12, 18, 24]},\n      {\"term_id\": \"R-HSA-162582\", \"supporting_discovery_ids\": [24, 36]},\n      {\"term_id\": \"R-HSA-9609507\", \"supporting_discovery_ids\": [11, 15, 16, 17, 28]}\n    ],\n    \"complexes\": [\n      \"GluK2/GluK5 heteromeric kainate receptor\",\n      \"GluK5-PSD-95/SAP90 complex\",\n      \"GluR6/KA2-PSD95-MLK3 signaling module\"\n    ],\n    \"partners\": [\n      \"GRIK2\",\n      \"GRIK1\",\n      \"GRIK3\",\n      \"DLG4\",\n      \"DLG1\",\n      \"CASK\",\n      \"DLG3\"\n    ],\n    \"other_free_text\": []\n  }\n}\n```"}